Busch Lab

ZMP

mcamb

Ensembl ID:
ENSDARG00000005368
ZFIN ID:
ZDB-GENE-030219-213
Description:
melanoma cell adhesion molecule b [Source:RefSeq peptide;Acc:NP_001012367]
Human Orthologue:
MCAM
Human Description:
melanoma cell adhesion molecule [Source:HGNC Symbol;Acc:6934]
Mouse Orthologue:
Mcam
Mouse Description:
melanoma cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:1933966]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa32033 Nonsense Available for shipment Available now
sa10561 Nonsense Available for shipment Available now
sa16313 Nonsense Available for shipment Available now
sa35880 Nonsense Mutation detected in F1 DNA Not yet available
sa39042 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32033
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020425 Nonsense 55 617 2 15
ENSDART00000115362 Nonsense 55 630 2 16
Genomic Location (Zv9):
Chromosome 15 (position 22643353)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23354540
GRCz11 15 23289805
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGATCAGCTGTACTTACACTCTGACGGAAGAAGCCAAGATGATAATCTG[G/A]TTTACGGTGAGAAAAAGACATGTTCATAATCTACACTGTTTAATATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10561
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020425 Nonsense 95 617 3 15
ENSDART00000115362 Nonsense 95 630 3 16
Genomic Location (Zv9):
Chromosome 15 (position 22640492)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23351679
GRCz11 15 23286944
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATYGATCAGAACCATGAATATGCAGAKCGGATCAAAGTCAGTCACTCTTA[T/G]GACACAGAGGAAGAGCRTGGTAGTGTTGTTCTGATCCTCGACGATGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16313
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020425 Nonsense 112 617 3 15
ENSDART00000115362 Nonsense 112 630 3 16
Genomic Location (Zv9):
Chromosome 15 (position 22640443)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23351630
GRCz11 15 23286895
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AKGACACAGAGGAAGAGCRTGGYAGTGTTGTTCTGAWYCTCGACGATGTG[C/T]AACTGACTGATGAGAGAGAGTTCWTMTGCATGGTGCACAGWGTGTTGAAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35880
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020425 Nonsense 218 617 6 15
ENSDART00000115362 Nonsense 218 630 6 16
Genomic Location (Zv9):
Chromosome 15 (position 22639882)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23351069
GRCz11 15 23286334
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACGGTCAAACCAAGTGGCCTGTTCAGGGTAGAGAGTGAACTGCATATC[A/T]AAGTCAAGAAGGAAGATGAAGGTGCTCATTTCTACTGTGAAGTCAAGTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4604
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020425 Essential Splice Site 254 617 6 15
ENSDART00000115362 Essential Splice Site 254 630 6 16
Genomic Location (Zv9):
Chromosome 15 (position 22639772)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23350959
GRCz11 15 23286224
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTAAAGCAAGAATGACAGAGTCCAGTCGATTCAACGTCACAGTTCATTG[T/A]GAGTCAGATTGCTTTCAGCCTGCTTCTAATTTAAATAGGCAGTTCACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39042
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020425 Nonsense 521 617 12 15
ENSDART00000115362 Nonsense 521 630 12 16
Genomic Location (Zv9):
Chromosome 15 (position 22634467)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23345654
GRCz11 15 23280919
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGCAGCGCCACCAATGAGCTGGGCACAGATGATGCTTCTCAAAGCATT[A/T]AAGCATGTAAGTGTTTGTTTTCAGACTGGATGAATTCCTCTACTTGAAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28447
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020425 Nonsense 574 617 14 15
ENSDART00000115362 Nonsense 587 630 15 16
Genomic Location (Zv9):
Chromosome 15 (position 22629519)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23340706
GRCz11 15 23275971
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGAAGCGTGCTCTATTACCTCTACAAGAAGGGAAAGCTGCCCTGTGGA[C/T]GATCAGGAAAGAAGGACTTGTATGTGAACATTTTTTATTTCTAATATACT
Associated Phenotype:
Not determined