Busch Lab

ZMP

sucla2

Ensembl ID:
ENSDARG00000005359
ZFIN ID:
ZDB-GENE-040426-1963
Description:
succinyl-CoA ligase [Source:RefSeq peptide;Acc:NP_998191]
Human Orthologue:
SUCLA2
Human Description:
succinate-CoA ligase, ADP-forming, beta subunit [Source:HGNC Symbol;Acc:11448]
Mouse Orthologue:
Sucla2
Mouse Description:
succinate-Coenzyme A ligase, ADP-forming, beta subunit Gene [Source:MGI Symbol;Acc:MGI:1306775]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa20646 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20646
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018503 Nonsense 155 466 4 11
Genomic Location (Zv9):
Chromosome 6 (position 9957846)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 9811653
GRCz11 6 10047192
KASP Assay ID:
2259-7195.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGGCAAGAAGCTTTTCACCAAGCAGACAGGAGAAGCAGGACGCATTTG[C/A]AATCAAGTGTTTGTCTGTGAGCGCAGATACCCACGCAGAGAGTATTACTT
Associated Phenotype:
Not determined