Busch Lab

ZMP

dip2ba

Ensembl ID:
ENSDARG00000005350
ZFIN ID:
ZDB-GENE-040426-2305
Description:
Disco-interacting protein 2 homolog B-A [Source:UniProtKB/Swiss-Prot;Acc:Q6NVJ5]
Human Orthologue:
DIP2B
Human Description:
DIP2 disco-interacting protein 2 homolog B (Drosophila) [Source:HGNC Symbol;Acc:29284]
Mouse Orthologue:
Dip2b
Mouse Description:
DIP2 disco-interacting protein 2 homolog B (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2145977]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa29943 Nonsense Mutation detected in F1 DNA Not yet available
sa37730 Essential Splice Site Available for shipment Available now
sa6740 Nonsense Mutation detected in F1 DNA Not yet available
sa37729 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa29943
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019521 Nonsense 40 1577 2 38
Genomic Location (Zv9):
Chromosome 23 (position 27636474)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27469296
GRCz11 23 27395837
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTTGTTCTCGCAGGTGACATCACACAGAAAGGCTATGAAAAGAAG[C/T]GAGCTAAACTGCTGGCTCCATTCGTACCACAGACCCAAAGTAAGACTTCC
Long Flanking Sequence:
CCTTTCTACACAGCTATGCTCTGGGTCTTTTTTTTCCCCCAACAACAATGGCAAGGCCGGTTGTGGGCGAAAGACCAAAACTATAATAAACTTTTGCAGACTGACCTAAATCTGTTGCCGTGTGGACGGGGTCTGAAACTAGAATGACAAACTTTGTGTTTGCAACTAACTGAAATAAAGTAAACAAACAAAATAAGACTAAAGCCTGATTTAAATACGTTTGCATAACAAATTGGCCTTAAAAAACATTTCTCCTTTTGTCTTTCAGATGAGAAGAGCATTAAGCAATGAGTTATCAAAGTATAAGCAATAGCAGTGATGCTTTGCTTCAGCAATTACCTGCAATCATGAAAAATGCTTAGAAAAGCTAGTGTGCTCAAGCTCAGCTTATGGTTGCAGACACATGGTTTCATTACATCTTATAAAGATATTTACATGTTTGCTTCTTGTTGTGTTTTGTTCTCGCAGGTGACATCACACAGAAAGGCTATGAAAAGAAG[C/T]GAGCTAAACTGCTGGCTCCATTCGTACCACAGACCCAAAGTAAGACTTCCTGTTTGCTAATTTCCCCCGTCCTCTCTGTTTCTTCTTTTATGTATCTTTACTCATCGCAGTGCCATCAACACAGTCCATGTTTATGTAAAGATGCTTTCATTTTACTGCTCTTGCACTAATTAAATGTTCATTAATGATGTGTTTGAACTTGGTTTCTTTTCCTACAATTATTTGCAAATGTGTAGCTTCATGCTGCACCCTAGTGGGGATCTGTAGAAATCTCATCAGTCCCTTCATTAAGAGGCTGCACTAAAATCAAATGAATGCTTGAAATAGTTTTGTGGCCGAAGACATTAGCAAACCATCTTCTTATCTGGAAGCTCCAAGTTGTTTAATCTCTTCTGATCACAGCACTTTCCGGCCTGTTAATGTCCATATACACATGCAAACATACACAGACTTCCTCTAAGCTGCATATAGAAGGAACCAAAACGGGAATTCACTGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37730
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019521 Essential Splice Site 217 1577 5 38
Genomic Location (Zv9):
Chromosome 23 (position 27629764)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27462586
GRCz11 23 27389127
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGGGCAGACCAGTGCGCTCGCAGATGTGCTGGCACACACCCGCATAGG[T/C]ACTGCAGGATCATGAGTCACACAAACACACGTGTTCAAGTGCTGAATCAC
Long Flanking Sequence:
ATATTATGTTAATAACTCTATTTTATAGAACCATATTAAGTTAATATGGAATGTACCAGTTAATAGGAATGTAATGCAATTATTACCAGTCTGTTGATCACAAATTCTATAACGCTGCTTATTCTATCTTAAGTTGTCATATCAAACTCATCATGTATATGTGTCTGCCTTTTGTGGTCTTTATCTGTAAGCTTTTCGTTTTTATTTCTATTCATTATTATCTTTTTAAACTGTTGTTGTATGCATGTGGCCACAGATACATCGTCAGCGTCGGAGGATGAGGGCTCCCTGCGCCGGCGTCAAGCCGCAATCAGTGCAATGCTGGCTCAGAACCTCCAGAGTCCCGAATACTGGATCAACCGATCAGTCCAGGGCTCCTCCACATCCTCCTCCGCCTCCTCCACGCTTTCTCACGGAGATGGCAAAACGCACAACCACAACAACCACAGCCAGGGGCAGACCAGTGCGCTCGCAGATGTGCTGGCACACACCCGCATAGG[T/C]ACTGCAGGATCATGAGTCACACAAACACACGTGTTCAAGTGCTGAATCACAGACGACACAAAGAAGAGCTTCAGTTTTTATATGTCTGGTACTTACGTAAGCTTGATTTACTTCCCAGTGATCAGGGCAAAGGAAAACAGCAGCAGATCTTAATTTCCAAGTTCGTCAGCTTTAACGGTGGCTATGCAAACCTGTTTGTTCAGTTGTGTGTCATATTGAATGCTGGATGAATCACTATGCTGTTATGTGTCTCCTTTACAGATACCAACAGCAGTAGTGGCAGTGTCCCGCCTGACGTCACGTCCACAGCGCCCCAGGACAGGAACTCCAGAGTAGACCTGCCAGCCAACATCGCAGTGAAGGGCATAAGCCGAGGCCAGAGCCGATCCAGTATGATGGACACTGCCGGCGGTATGGACAGCCTCACACACAGCTCTTACATGCTGGAGACCTTGAACTTCCTGAACTGTTAGACTTGTAGGACCCAGTTTGGCCAACAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5053
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019521 Essential Splice Site 804 1577 21 38
Genomic Location (Zv9):
Chromosome 23 (position 27619042)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27451864
GRCz11 23 27378405
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAACAAAGCCTCTTTCTATTTGCCTCTGTGTCACAATAATTTGTACCCTC[A/T]GGGAAGTTTGGTGTTTGTGGTGGGAAAGATCGAGGGTCTGCTTAGTGTCA
Long Flanking Sequence:
CAGGTGGTACCCCGATAGGAGACGTTCCCTTCACACGCACTGGACTTTTGGGCTTTGTGGGTCCGGTAAGTAGAAATACAGTACCATTATGTGTATATATACATATTTTAAATGTATTTGTAATATCATATATTTTAAATGTATTTATTTTTATATATTATTTTAAAGTTTAGGTTCAGAAAGATTCTTTGGCAGAAATTAATAATTTAATTATAGAAAATCATATATTTTTTCCAAAACAATAAGTCCTGTATCTTGAGCATCAGGTCAGCATGTTAGTAGGATTTCTGAAGGGTCATGTGACACAGAAGACTGTAATAATAAATATAGAAAATGTTGCTGGATTTACATGTATTGGTCAAATATTCTCCTTTAATGAAAGAGAGAGAGAGACACCTGTACATAGAATAACAAGTCTGACCCCGCAATTTTCACAGTTAAATAAAGTATGAACAAAGCCTCTTTCTATTTGCCTCTGTGTCACAATAATTTGTACCCTC[A/T]GGGAAGTTTGGTGTTTGTGGTGGGAAAGATCGAGGGTCTGCTTAGTGTCAGTGGTCGCAGACACAATGCAGATGACCTGGTGGCCACAGCACTGGCAGTGGAGCCAGTCAAAACCGTTTACAGAGGAAGGTACGAACAAAACATATCGAAATTACAGGTGTTTAGACCGTTTTGGTAATGTGATGAGGTTCTGAGAGTGTCTGTCATGTATGCAGGATTGCCGTGTTCTCTGTTACTGTGTTCTATGATGAGCGGGTAGTGATTGTTGCAGAGCAGAGGCCTGACGCCAATGAAGAGGACAGTTTTCAGTGGATGAGCAGAGTCTTGCAGGTAACACACAAGCCTTCTTAAAACTTCATTTGTGTAAAGTAAAGTAGGTCATTGATATAAATGGACCTCAGCTCACTGGCTTCATCTAATGAAGCAAATAACAATGATAAATTCACAATATCCAATGATTCTACACTTTCATAATAATAAGTGTCATAACTCTTCTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6740
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019521 Nonsense 895 1577 23 38
Genomic Location (Zv9):
Chromosome 23 (position 27618484)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27451306
GRCz11 23 27377847
KASP Assay ID:
554-4793.1 (used for ordering genotyping assays)
KASP Sequence:
TNGACTGTGTTCCTATAGGCTATAGACAGTATCCACCAGGTGGGCTTGTA[T/A]TGTTTGGCGCTGGTGCCTGCAAATACATTACCCAAAACTCCACTGGGTGG
Long Flanking Sequence:
CAGACACAATGCAGATGACCTGGTGGCCACAGCACTGGCAGTGGAGCCAGTCAAAACCGTTTACAGAGGAAGGTACGAACAAAACATATCGAAATTACAGGTGTTTAGACCGTTTTGGTAATGTGATGAGGTTCTGAGAGTGTCTGTCATGTATGCAGGATTGCCGTGTTCTCTGTTACTGTGTTCTATGATGAGCGGGTAGTGATTGTTGCAGAGCAGAGGCCTGACGCCAATGAAGAGGACAGTTTTCAGTGGATGAGCAGAGTCTTGCAGGTAACACACAAGCCTTCTTAAAACTTCATTTGTGTAAAGTAAAGTAGGTCATTGATATAAATGGACCTCAGCTCACTGGCTTCATCTAATGAAGCAAATAACAATGATAAATTCACAATATCCAATGATTCTACACTTTCATAATAATAAGTGTCATAACTCTTCTCTCTTTTTTTTTTGACTGTGTTCCTATAGGCTATAGACAGTATCCACCAGGTGGGCTTGTA[T/A]TGTTTGGCGCTGGTGCCTGCAAATACATTACCCAAAACTCCACTGGGTGGTATTCATGTGTCTGAGACCAAACATCATTTCCTGGAGGGATCTCTGCATCCCTGCAACATTCTGATGTGCCCTCATACTTGTGTCACAAACCTTCCAAAACCCAGACAAAAGCAGCCAGGTACTCTAAAAATAAATACATTTTTAAAAACATAAGTACATACAGTTGAAGTCAAAATTATTAGTCATCCTGTGATTTTTATTTTTATTTTTCAAATATTTCCCAAAAGATGTTTAACAAAGTAAATAATTTTTTACAGTATGTCTGATAATAATTTTTCCTCTAGAGAAAGTCTTATTTGTTTTATTTTGGCTAGAATAAAAGCAGTTTTTAATTTTCAAATTAAGTTTTACTGAAGGTCAAAATTATGAGGCCCTTTAAGCTATAGTTTTTTTTTATGTCACCAGAACAAACCACTTTTATACAATGATTTGCTTAACTACCTCAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37729
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019521 Nonsense 1406 1577 36 38
Genomic Location (Zv9):
Chromosome 23 (position 27602354)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27435176
GRCz11 23 27361717
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATTTTCCTCTCAGATCTGGGTGAACAGTCCTCATAACGCCAGTGGTTA[T/G]TATACGATCTATGGTGAGGAGAGCCTGCAGGCAGACCACTTCAACACTCG
Long Flanking Sequence:
ATGTGTCCTAATAGTGTTTTTAGCAACGTGGGACATAAACATGCCTGTTAACATCTCAAAAAATGTGTTTAGGTGTGTTTCGTGACCCTTTAACGTCTAGCCGAACTCAAATAATGTCATCAAACTATTTTAAGTGAGTCTTCATGTGAGAAATTATACAAGAAAAATCATGTTACAGCTACATTTCAGATGCTACAAAAATTGTGACCTATTACTGGAAAATTCCTGACCAGCACTGTTCATCTTGCATGGTGGTTATATATTATCTTCTGTGCTTTACCTCAGATGCTTCCTGGAGTGAGAGTTATCATTGTGAACCCAGAGACTAAAGGACCACTAGGAGACTCTCATCTAGGAGAGGTGAACAATTACATTTGGATTATTACAGAACTACAATTTATTTTTAAGGATGTAAACCTGTGTGACTGTTACTCATCTCTGTTGCTCTTTGCATTTTCCTCTCAGATCTGGGTGAACAGTCCTCATAACGCCAGTGGTTA[T/G]TATACGATCTATGGTGAGGAGAGCCTGCAGGCAGACCACTTCAACACTCGGCTGAGCTTCGGGGACACTGAAACGCTCTGGGCCAGAACTGGATATCTGGGATTTGTCAAGAGGACTGAGCTGCTGGACGCCAGTGGAGGTGATTGCTAAATCTTTTATGCTAAATGGCAGTGAGAACGTATGATAAAAATTTGTTCAATTAAATTAAACTGCATACATACAGTGCATCTAAATTGAGCTCAGGTACATTCTGCTTCGACTGATCATTCTTGAAATGTTTCAGCAGCTTATTTAGAGTTCACCTGTGGTAAATTCAGTTGATTGGACCTGATTTGAAAAGGCATACACCTGTCTATATAAGGTGTTGACTACCCAGGGTTGACAGTGCTCACTTTTCTTTTCCATTTTCCTCAACCAGATCGCCATGATGCTCTGTTCGTGGTGGGTTCCCTCGATGAAACACTGGAGTTGCGAGGTTTGCGTTATCATCCCATTGACAT
Associated Phenotype:
Not determined