Busch Lab

ZMP

slc22a4

Ensembl ID:
ENSDARG00000005335
ZFIN ID:
ZDB-GENE-040426-1517
Description:
solute carrier family 22 member 4 [Source:RefSeq peptide;Acc:NP_957143]
Human Orthologues:
SLC22A4, SLC22A5
Human Descriptions:
solute carrier family 22 (organic cation/carnitine transporter), member 5 [Source:HGNC Symbol;Acc:10
solute carrier family 22 (organic cation/ergothioneine transporter), member 4 [Source:HGNC Symbol;Ac
Mouse Orthologues:
Slc22a21, Slc22a4, Slc22a5
Mouse Descriptions:
solute carrier family 22 (organic cation transporter), member 21 Gene [Source:MGI Symbol;Acc:MGI:192
solute carrier family 22 (organic cation transporter), member 4 Gene [Source:MGI Symbol;Acc:MGI:1353
solute carrier family 22 (organic cation transporter), member 5 Gene [Source:MGI Symbol;Acc:MGI:1329

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa24040 Essential Splice Site Available for shipment Available now
sa19273 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24040
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024342 Essential Splice Site 483 553 8 10

The following transcripts of ENSDARG00000005335 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 44232937)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45864278
GRCz11 21 45902625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGACGGCCCGCATCGGCAGCATCATCTCGCCCTTCATCATATACCTGG[G/A]TATCTTCTTCTGCTGCGGTATTAGCATTACCGCTGATGTTAATGCTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19273
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024342 Nonsense 528 553 9 10

The following transcripts of ENSDARG00000005335 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 44233151)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45864492
GRCz11 21 45902839
KASP Assay ID:
2261-6133.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGCAAAGGAAAGGTTCTGCCAGAGACCATCGCTCAGATGCAGAGCGTA[C/T]GAGGGTAAATATACCGGCCTGCTGCAGTAAACTACTGTAAACACTGACTG
Associated Phenotype:
Not determined