Busch Lab

ZMP

ftr66

Ensembl ID:
ENSDARG00000005327
ZFIN ID:
ZDB-GENE-070912-661
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa39888 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6017
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049492 Nonsense 121 548 1 6
ENSDART00000138591 Nonsense 109 288 1 3
Genomic Location (Zv9):
Chromosome 2 (position 37484149)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37780859
GRCz11 2 37763316
KASP Assay ID:
554-3844.1 (used for ordering genotyping assays)
KASP Sequence:
ATCAAACAAAAGGCTGTGAAGTCTTGCTTGGTATGTTTGGCATCTTACTG[T/A]CAGAATCATCTTGAAGCACACTACAAATCTCCAGCCTTGAAGAAACACAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3413
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049492 Essential Splice Site 194 548 None 6
ENSDART00000138591 Essential Splice Site 182 288 None 3
Genomic Location (Zv9):
Chromosome 2 (position 37484370)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37781080
GRCz11 2 37763537
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAGGGTCATGATRTCGTACCAGGAGATGTGGAAAGTACAAAGAAACAGG[T/A]ATGGTTTTTTMTTTTACTTTGCTTGCTTGAAGTGTGTATTAGAGAGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39888
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049492 Nonsense 327 548 4 6
ENSDART00000138591 None None 288 None 3
Genomic Location (Zv9):
Chromosome 2 (position 37487550)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37784260
GRCz11 2 37766717
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGACTTCCTGACCCTCCGTTCACAATAGCGTCACTTTCCGATTTCGGC[A/T]AAGTAAACGATGCGATTTCTGTTTTAAAGAAGAAGCTTGAAGATGTCTTT
Associated Phenotype:
Not determined