Busch Lab

ZMP

asb3

Ensembl ID:
ENSDARG00000005246
ZFIN ID:
ZDB-GENE-030131-6142
Description:
ankyrin repeat and SOCS box protein 3 [Source:RefSeq peptide;Acc:NP_956168]
Human Orthologue:
ASB3
Human Description:
ankyrin repeat and SOCS box-containing 3 [Source:HGNC Symbol;Acc:16013]
Mouse Orthologue:
Asb3
Mouse Description:
ankyrin repeat and SOCS box-containing 3 Gene [Source:MGI Symbol;Acc:MGI:1929749]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3828
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021298 Essential Splice Site 468 519 8 9
ENSDART00000110173 Essential Splice Site 299 350 5 6
Genomic Location (Zv9):
Chromosome 12 (position 25583461)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23952137
GRCz11 12 24073356
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCGCTCACCGGCGAGCCGAGGGCACCTGGACACCACGTAAACATTTCGG[T/A]ATGACATTATTGTATGTTTGAGTGGGTGTGTTTACATGAGCATCAGTAAT
Associated Phenotype:
Not determined