Busch Lab

ZMP

zgc:158328

Ensembl ID:
ENSDARG00000005216
ZFIN ID:
ZDB-GENE-070112-1202
Description:
hypothetical protein LOC567225 [Source:RefSeq peptide;Acc:NP_001073658]
Mouse Orthologue:
Egfem1
Mouse Description:
EGF-like and EMI domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1922990]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa10975 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28508
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066737 Nonsense 102 802 4 19
Genomic Location (Zv9):
Chromosome 15 (position 34561351)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35407127
GRCz11 15 35265096
KASP Assay ID:
2260-8832.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAGACCTGAGTGATGTCTTATCTACAGGAGTGTGTTCCTCTGGTACCTG[T/A]TTTAATGGTGGGAAGTGCTCTGAGACCAGCGATCACCTATGTCAGTGTCC
Long Flanking Sequence:
ACTGTATGGCCATTTCCACATACTGATCTCGTATACCCAGATTTTCATTATAGGGCACCTTTAACATTCAGCCATGTAATTCCTATTCCAGTAACAAGCCTATGTTATTTCCGAAGATCAGAAACAATAATTGTCTTCTGGTGTCTTCAAATATTTTCATCCATTTCTGCTAAATATTGTGTTTAATCAATTTCAGCATTGTTTATATCTCATTTGTCATATTCAAGCAATGTCTTTCTGTATAATGAAATAGTTTTTTCTATTTCTGAATCTACTTCTCCATCTGTCTGTCTCAGGACAGGGTATTATACAGTGTATAAACAGGCATACAACATGGAGATGCAGACCGTCTTCAGGTGCTGCCCAGGATGGATGCAGAGAGGAGAAGAGAGAGGCTGTTTGCACAGTGAGCATCATTTTCATTTTCTTTGTTCATAATTTGGATGCAGAGTAGACCTGAGTGATGTCTTATCTACAGGAGTGTGTTCCTCTGGTACCTG[T/A]TTTAATGGTGGGAAGTGCTCTGAGACCAGCGATCACCTATGTCAGTGTCCAGAAGGGTTTGAGGGAACGCGTTGTCAATATGGTGAGTCAATATCTGCATATTTGAGGTTGAAATTTGACACGAGTCTGACTTAAACTATGTAAAAAATGATTGCGCCAATTAGTTATCACCACTTTATATTTCAACCCAAGCTCATTCTGAAAACGTAGTCCCGCGGACGTTTCTGGAGATAGCGGAATACGTCCCGGGGGGTACGTACGGCTGCGTTTATTTTTTTCAAGCGAACGCTGCGGGGCGGTGTGATGCTGTTCCATTTTACGCTTGCCGTACCTCTTTGTGGAGGGCTTCCCCGCTGCAACCCGTTTGTCCACTCAGCTCACCGTGTATGTCGGCAGGCTCGAGATGTAGAGAGGAGTCGACCACGGTGACCGGTTTTGAGTCCGGGGAAGAGCGGTTCCAGCAATCAGGTAAGACAAAAACAGAATCCCAAAAATTAAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7769
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066737 Nonsense 223 802 7 19
Genomic Location (Zv9):
Chromosome 15 (position 34596053)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35441829
GRCz11 15 35299798
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGTGACTATTTCCAGCRGTGAACTCTTGCTCAGTGAAGAATGGCGGATG[T/A]GAACACAAGTGTGTGGATTTGGGAAACGAACAGTACAAGTGTGAATGTCG
Long Flanking Sequence:
ATTGTTTTTCTGGTGTATCAGGAGATAAGGATTGGTAGCCAGATCGTTTCAGAACTGTTTACAGACTTCCAAGTTTTTTTCTCTCTTAGTTTTCACTTAGAAAAGCAACTGACACATGGAATTAAACACTAAGCTCTGAAGTAAAAATTTCTATTGTATTTTTATTAAGTTTACTTCTTATATTATAATATAAAACAAGTTTTTTCTTGGTTTATCTTACTTTGTATATCTTTATCATTATCATATGTATAATTTTATTTTTAAATAATTTTCACACACTGAAGCGTTATTTCAGGTGGTGTAAAACTGGTCAAAATTATTAAAAAAGAATTCAATTAGGCAAGAAAGACTGAAAATGTTTTTTTTTTTTTCCCATTGTACTCCATAAACCCAACACTCAGATGGTACCATATAGATTTTTTTCATGATCATAAAATTCATTTTAAGTGTATGTGACTATTTCCAGCGGTGAACTCTTGCTCAGTGAAGAATGGCGGATG[T/A]GAACACAAGTGTGTGGATTTGGGAAACGAACAGTACAAGTGTGAATGTCGAAGCAACTACCAGCTCAAGAGAGACGGAAAGCACTGTGAACGTGAGTCGACATGCATGCGCCATCTTTGACTAACGTCCCGTTGTGATGTTTATGAGGGTGTATCCTGTGTTCTCCTCAGTGAAGGACCCCTGTAAAGATCATAACGGCGGATGTTCTCAAATCTGCACTGATGTGAATGGACTGGTTCAGTGCAGCTGCAGAACAGGATTCACATTGGCAAATGACCTCAGGAGATGTGAAGGTTTGTGAGCATTACACGGATTATCAAATAGATAGATTTAAAGGTAAATAAATAGTGTTCATTTGATGGTCCAGTGCTAGACCCAAATACTACACCTTTAGAATAATTAGCCAATATCAAACATTTGTTTTCAGTACATATAATGTAGTTTTATTCCACCAAAATGTATATTAAATAAATATTAATTTACACAAGAAGAATGAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10975
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066737 Nonsense 278 802 8 19
Genomic Location (Zv9):
Chromosome 15 (position 34596297)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35442073
GRCz11 15 35300042
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAYGGCGGRTGTTCTCAAATCTGCACTGATGTGAATGGACTGGTTCAGTG[C/A]AGCTGCAGAACAGGATTCACATTGGCAAATGACCTCAGGAGATGTGAAGG
Long Flanking Sequence:
ATGTATAATTTTATTTTTAAATAATTTTCACACACTGAAGCGTTATTTCAGGTGGTGTAAAACTGGTCAAAATTATTAAAAAAGAATTCAATTAGGCAAGAAAGACTGAAAATGTTTTTTTTTTTTTCCCATTGTACTCCATAAACCCAACACTCAGATGGTACCATATAGATTTTTTTCATGATCATAAAATTCATTTTAAGTGTATGTGACTATTTCCAGCGGTGAACTCTTGCTCAGTGAAGAATGGCGGATGTGAACACAAGTGTGTGGATTTGGGAAACGAACAGTACAAGTGTGAATGTCGAAGCAACTACCAGCTCAAGAGAGACGGAAAGCACTGTGAACGTGAGTCGACATGCATGCGCCATCTTTGACTAACGTCCCGTTGTGATGTTTATGAGGGTGTATCCTGTGTTCTCCTCAGTGAAGGACCCCTGTAAAGATCATAACGGCGGATGTTCTCAAATCTGCACTGATGTGAATGGACTGGTTCAGTG[C/A]AGCTGCAGAACAGGATTCACATTGGCAAATGACCTCAGGAGATGTGAAGGTTTGTGAGCATTACACGGATTATCAAATAGATAGATTTAAAGGTAAATAAATAGTGTTCATTTGATGGTCCAGTGCTAGACCCAAATACTACACCTTTAGAATAATTAGCCAATATCAAACATTTGTTTTCAGTACATATAATGTAGTTTTATTCCACCAAAATGTATATTAAATAAATATTAATTTACACAAGAAGAATGAACATTTATACTTATGTTATACTTCTGTTTATCGGAATTCAGTTTAGTGTGTTTGTTATTGTATTATTTTAGTTTAGTTTGGATTAATTTATTTTAATTTAATTTATCTTGTACTCACTATTTTTTTTTTTTTTTGCGTAATTTTTTTATAGTACTTTGGCTTACTTTTGTTTAATTTTGATTGATCTGTTTTGTTTAGTTTAGATTTTGTAAATAATTTACTTGTATTTAATTTTATAAAGCATTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7770
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066737 Nonsense 356 802 10 19
ENSDART00000066737 Nonsense 356 802 10 19
Genomic Location (Zv9):
Chromosome 15 (position 34600541)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35446317
GRCz11 15 35304286
KASP Assay ID:
2260-8835.1 (used for ordering genotyping assays)
KASP Sequence:
GAGATTGTGAACGGCTGTGAGAAAAACAACGGTGGCTGCTCTCATCGCTG[T/A]GAACACACCACCAGCGGGCCCTTGTGCTCCTGCAACCAAGGCTACCAGCT
Long Flanking Sequence:
CGTAAATCCGTCATGGAATTTTTTCATCATGGGAAAATTCAAAATACTGTTTTTAATATTATTGTGTATTTTCTTTATTGTTGTCATTTTGTAAATGCTGCTTTTAAATGTTTTTTTAATTGTTCATAATTATTTATTGTTCTTATTTATATTAAGTCTTATGTACGGTGACCATGAGTGGTTTGAAAGGCAAACAATAATGAAATGGAATGTATTATTATTATTATTATTATTATTATGGGTAATGCACTTTTTTGTGCGAATATGGTAATTTAGTATGAATATTAAAAAAAATAGTTTAAAATAATTTCCATATAAAATTCATTAACAAACTTCAAAGGTTTATCGGTTGTTAAAAATGAGTAAAATTTTTGAGAAATGAAAAAGGTTTTCACTTCTGGACACAAACGTGAATAATGTGAAGTGACGTATCCTGCAGGAATAGAGATGGAGATTGTGAACGGCTGTGAGAAAAACAACGGTGGCTGCTCTCATCGCTG[T/A]GAACACACCACCAGCGGGCCCTTGTGCTCCTGCAACCAAGGCTACCAGCTCGCTGAAGACCTTAAGACATGCATAGGTATGTAGGCCGCATGATAGGTCTAAAGTCGCACTGCACTTTTCCATTCACACGCATGCCAATGCCACAGACGGAAACACATGCTGGTTCTGCAAGTTTAGCAGTTCGCTGAGTTGCAAAGTTCAAGTTTGGTCTGCGAAATCGCATTATGTGATGAGAGCATGAGAGCAATAGAAAATCAGAACATGACCTCTCTGGAGCGAAATTTAAAACATGGATCAATCGCTCCTTTTTTATGTCTACTTTTTTTATCCCGCTCCTTTTCACAGCGCTGCATGACAGAATTTTGCATGCTCAAACTCTGTTGTGACCACAGCATAAGACCATATAGTTATTTTGACATTATGAATTATGCATGAACATTACTGTATGTAAATTTGGGGCTGGAAACAAAAAGATGTTGCAAAATGCTTGATTTACCATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19123
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066737 Nonsense 356 802 10 19
ENSDART00000066737 Nonsense 356 802 10 19
Genomic Location (Zv9):
Chromosome 15 (position 34600541)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35446317
GRCz11 15 35304286
KASP Assay ID:
2260-8835.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGATTGTGAACGGCTGTGAGAAAAACAACGGTGGCTGCTCTCATCGCTG[T/A]GAACACACCACCAGCGGGCCCTTGTGCTCCTGCAACCAAGGCTACCAGCT
Long Flanking Sequence:
CGTAAATCCGTCATGGAATTTTTTCATCATGGGAAAATTCAAAATACTGTTTTTAATATTATTGTGTATTTTCTTTATTGTTGTCATTTTGTAAATGCTGCTTTTAAATGTTTTTTTAATTGTTCATAATTATTTATTGTTCTTATTTATATTAAGTCTTATGTACGGTGACCATGAGTGGTTTGAAAGGCAAACAATAATGAAATGGAATGTATTATTATTATTATTATTATTATTATGGGTAATGCACTTTTTTGTGCGAATATGGTAATTTAGTATGAATATTAAAAAAAATAGTTTAAAATAATTTCCATATAAAATTCATTAACAAACTTCAAAGGTTTATCGGTTGTTAAAAATGAGTAAAATTTTTGAGAAATGAAAAAGGTTTTCACTTCTGGACACAAACGTGAATAATGTGAAGTGACGTATCCTGCAGGAATAGAGATGGAGATTGTGAACGGCTGTGAGAAAAACAACGGTGGCTGCTCTCATCGCTG[T/A]GAACACACCACCAGCGGGCCCTTGTGCTCCTGCAACCAAGGCTACCAGCTCGCTGAAGACCTTAAGACATGCATAGGTATGTAGGCCGCATGATAGGTCTAAAGTCGCACTGCACTTTTCCATTCACACGCATGCCAATGCCACAGACGGAAACACATGCTGGTTCTGCAAGTTTAGCAGTTCGCTGAGTTGCAAAGTTCAAGTTTGGTCTGCGAAATCGCATTATGTGATGAGAGCATGAGAGCAATAGAAAATCAGAACATGACCTCTCTGGAGCGAAATTTAAAACATGGATCAATCGCTCCTTTTTTATGTCTACTTTTTTTATCCCGCTCCTTTTCACAGCGCTGCATGACAGAATTTTGCATGCTCAAACTCTGTTGTGACCACAGCATAAGACCATATAGTTATTTTGACATTATGAATTATGCATGAACATTACTGTATGTAAATTTGGGGCTGGAAACAAAAAGATGTTGCAAAATGCTTGATTTACCATA
Associated Phenotype:
Not determined