Busch Lab

ZMP

tpm3

Ensembl ID:
ENSDARG00000005162
ZFIN ID:
ZDB-GENE-030826-16
Description:
tropomyosin 3 isoform 2 [Source:RefSeq peptide;Acc:NP_958900]
Human Orthologues:
AC103988.1, TPM1, TPM2, TPM4
Human Descriptions:
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JE83]
tropomyosin 1 (alpha) [Source:HGNC Symbol;Acc:12010]
tropomyosin 2 (beta) [Source:HGNC Symbol;Acc:12011]
tropomyosin 4 [Source:HGNC Symbol;Acc:12013]
Mouse Orthologues:
Tpm1, Tpm2, Tpm3-rs7, Tpm4
Mouse Descriptions:
tropomyosin 1, alpha Gene [Source:MGI Symbol;Acc:MGI:98809]
tropomyosin 2, beta Gene [Source:MGI Symbol;Acc:MGI:98810]
tropomyosin 3, related sequence 7 Pseudogene [Source:MGI Symbol;Acc:MGI:99705]
tropomyosin 4 Gene [Source:MGI Symbol;Acc:MGI:2449202]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa16993 Nonsense Available for shipment Available now
sa23465 Essential Splice Site Available for shipment Available now
sa36795 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9640 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16993
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010997 None None 248 None 8
ENSDART00000027598 Nonsense 6 284 1 10
ENSDART00000137865 Nonsense 6 81 2 3
Genomic Location (Zv9):
Chromosome 19 (position 11521219)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11112971
GRCz11 19 11030969
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTCGGACCGTRAGCCCTTCTCACCAACGCCAAGATGGAGGCCGTCAAG[A/T]AGAAGATGATGATGCTGAAGCTGGATAAGGAGAATGCTCTGGACCAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23465
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010997 None None 248 None 8
ENSDART00000027598 Essential Splice Site 39 284 None 10
ENSDART00000137865 Essential Splice Site 39 81 None 3
Genomic Location (Zv9):
Chromosome 19 (position 11518479)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11110231
GRCz11 19 11028229
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCACTCTTTCAATCACAACCACTGTCAAATATCCCTTCTGTCTTCTCCC[A/T]GCATGAGGATGAGCTGATTCAGATGCAGAAGAAGCTGAAGGGAACTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36795
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010997 Essential Splice Site 152 248 4 8
ENSDART00000027598 Essential Splice Site 188 284 5 10
ENSDART00000137865 None None 81 None 3
Genomic Location (Zv9):
Chromosome 19 (position 11498934)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11090686
GRCz11 19 11008684
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTGAGGGAGAGTTGGAGCGTACAGAGGAGAGAGCAGAGCTTGCAGAGAG[G/A]TTAATCTCAGATTCACAATCAAAATATACATGCACATAATCCTCAGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9640
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010997 Nonsense 178 248 6 8
ENSDART00000027598 Nonsense 214 284 7 10
ENSDART00000137865 None None 81 None 3
Genomic Location (Zv9):
Chromosome 19 (position 11493070)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11084822
GRCz11 19 11002820
KASP Assay ID:
2261-3036.1 (used for ordering genotyping assays)
KASP Sequence:
CACAAGACCCCACCCCAATTCATAGTGCTCCATTTGTTTTCCCTACAGTA[T/G]TCCCAGAAGGAGGACAAGTATGAGGAAGAAATCAAGATCCTCACTGATAA
Associated Phenotype:
Not determined