Busch Lab

ZMP

CYTH3 (1 of 3)

Ensembl ID:
ENSDARG00000005159
Description:
cytohesin 3 [Source:HGNC Symbol;Acc:9504]
Human Orthologue:
CYTH3
Human Description:
cytohesin 3 [Source:HGNC Symbol;Acc:9504]
Mouse Orthologue:
Cyth3
Mouse Description:
cytohesin 3 Gene [Source:MGI Symbol;Acc:MGI:1335107]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10350 Essential Splice Site Available for shipment Available now
sa8572 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10350
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050576 Essential Splice Site 148 401 6 14
Genomic Location (Zv9):
Chromosome 3 (position 56853551)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 56374641
GRCz11 3 56442077
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGTGGAGCTCCACGAATTTGCCGACCTCAACCTCGTTCAGGCTCTGAG[G/A]TGGGAAAACTGTTCATTTCCTCCAAAAATGCTTGAATTTATTACATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8572
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050576 Nonsense 284 401 10 14
Genomic Location (Zv9):
Chromosome 3 (position 56828394)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 56349484
GRCz11 3 56416920
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTTGATTTGCTTTGCAGGTGGACGGGTAAAAACTTGGAAGAGGCGATG[G/A]TTTATTCTCACCGACAACTGCTTGTACTATTTTGAGTACACAACGGTAAG
Associated Phenotype:
Not determined