Busch Lab

ZMP

cdh17

Ensembl ID:
ENSDARG00000005112
ZFIN ID:
ZDB-GENE-030910-3
Description:
cadherin-17 [Source:RefSeq peptide;Acc:NP_919403]
Human Orthologue:
CDH17
Human Description:
cadherin 17, LI cadherin (liver-intestine) [Source:HGNC Symbol;Acc:1756]
Mouse Orthologue:
Cdh17
Mouse Description:
cadherin 17 Gene [Source:MGI Symbol;Acc:MGI:1095414]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa32091 Essential Splice Site Available for shipment Available now
sa36153 Nonsense Mutation detected in F1 DNA Not yet available
sa14279 Essential Splice Site Available for shipment Available now
sa11932 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32091
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042895 Essential Splice Site 93 868 None 19

The following transcripts of ENSDARG00000005112 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 29033164)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26908938
GRCz11 16 26782380
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGGAGCAACCTCTGGAATGGAGCCCTGAGAAAAAACACCATCTACTTG[T/C]AATTTAGTATTGCAGTCTAAAACACAACACAAAAAAATACAAGAACTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36153
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042895 Nonsense 186 868 6 19

The following transcripts of ENSDARG00000005112 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 29035467)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26911241
GRCz11 16 26784683
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCCATTGTCGGGCAAACATTTTTCTTTGGCATAAATCCAAACAATGGA[C/T]AGATATTTACAACAGAAGAAGGTACGGCAACATATATATGAACAAGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14279
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042895 Essential Splice Site 501 868 12 19

The following transcripts of ENSDARG00000005112 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 29043799)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26919573
GRCz11 16 26793015
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAGGTGAWCGAYATCAATGATGAGATCCCTATCTTCGAGAAAAACGATG[T/A]ATGTGCTTWTATTTKACTACCTACATAAACTGCGATCAATAGGTTGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11932
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042895 Nonsense 716 868 16 19

The following transcripts of ENSDARG00000005112 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 29047374)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26923148
GRCz11 16 26796590
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAAGGTGGACATTYATCTGCAGGATGTAAACKACAACTACCCTAAACTC[C/T]AGAAGACACAGGGCTTCATCTGCCTTCAGGACATGACCCCCTTGACCCTC
Associated Phenotype:
Not determined