Busch Lab

ZMP

glcea

Ensembl ID:
ENSDARG00000005095
ZFIN ID:
ZDB-GENE-040630-9
Description:
glucuronyl C5-epimerase a [Source:RefSeq peptide;Acc:NP_998015]
Human Orthologue:
GLCE
Human Description:
glucuronic acid epimerase [Source:HGNC Symbol;Acc:17855]
Mouse Orthologue:
Glce
Mouse Description:
glucuronyl C5-epimerase Gene [Source:MGI Symbol;Acc:MGI:2136405]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa1666 Nonsense Available for shipment Available now
sa8517 Nonsense Mutation detected in F1 DNA Not yet available
sa12861 Nonsense Available for shipment Available now
sa16942 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1666
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014274 Nonsense 205 585 3 4
Genomic Location (Zv9):
Chromosome 25 (position 8183906)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7796430
GRCz11 25 7920522
KASP Assay ID:
554-1613.1 (used for ordering genotyping assays)
KASP Sequence:
AGCCACTACAGCAAGAACCTCACAGAGAAACCTCCTGACATAAAGATCTA[T/A]GGCATGTTAGAGGAAAAAGAGGGTGGCTCAAGTCAGTGGGATGTCCCTAA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa8517
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014274 Nonsense 528 585 4 4
Genomic Location (Zv9):
Chromosome 25 (position 8182856)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7795380
GRCz11 25 7919472
KASP Assay ID:
2261-9384.1 (used for ordering genotyping assays)
KASP Sequence:
TCRCTCAAGGCCATGTTGCCATTGTTCGATACAGGCTCTGGAACAGTTTA[T/G]GACCTGAGACACTTTACCTTGGGTGTTGCCCCRAATTTAGCACGRTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12861
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014274 Nonsense 535 585 4 4
ENSDART00000014274 Nonsense 535 585 4 4
Genomic Location (Zv9):
Chromosome 25 (position 8182836)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7795360
GRCz11 25 7919452
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGTTCGATACAGGCTCTGGAACAGTTTAKGACCTGAGACACTTTACCT[T/A]GGGTGTTGCCCCRAATTTAGCACGRTGGGACTATCACAYCACGCACATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16942
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014274 Nonsense 535 585 4 4
ENSDART00000014274 Nonsense 535 585 4 4
Genomic Location (Zv9):
Chromosome 25 (position 8182836)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7795360
GRCz11 25 7919452
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGTTCGATACAGGCTCTGGAACAGTTTAKGACYTGAGACACTTTACCT[T/A]GGGTGTTGCCCCRAATTTAGCACGRTGGGACTATCACAYCACGCACATCA
Associated Phenotype:
Not determined