Busch Lab

ZMP

zgc:154151

Ensembl ID:
ENSDARG00000005034
ZFIN ID:
ZDB-GENE-061110-16
Description:
2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase-like protein [Source:UniProtKB/Swiss-Prot;A
Human Orthologue:
ISPD
Human Description:
isoprenoid synthase domain containing [Source:HGNC Symbol;Acc:37276]
Mouse Orthologue:
Ispd
Mouse Description:
isoprenoid synthase domain containing Gene [Source:MGI Symbol;Acc:MGI:1923097]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35955 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4618
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003192 Nonsense 210 432 4 11
ENSDART00000140882 Nonsense 226 448 3 10
Genomic Location (Zv9):
Chromosome 15 (position 33848284)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34694060
GRCz11 15 34552029
KASP Assay ID:
2260-8797.1 (used for ordering genotyping assays)
KASP Sequence:
CTGGAGAGAGCCAAGTACCGGGCCAGTGAAATGCCTCAAGGATTTCTTTA[T/G]GACATTATTTTYCAAGCCTACCAGCGGGTATGAGCAACCCAGACATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35955
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003192 Essential Splice Site 326 432 8 11
ENSDART00000140882 Essential Splice Site 342 448 7 10
Genomic Location (Zv9):
Chromosome 15 (position 33830443)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34676219
GRCz11 15 34534188
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCAATGTGCAGTACCTGTCCAAAACCCGAAACTTTATTCACATATCTG[T/G]ACGTCAACAGCACACGCAAACACAAAGTAATTCCACATTGAAGTCCACAT
Associated Phenotype:
Not determined