Busch Lab

ZMP

brf1b

Ensembl ID:
ENSDARG00000005002
ZFIN ID:
ZDB-GENE-030131-6248
Description:
transcription factor IIIB 90 kDa subunit [Source:RefSeq peptide;Acc:NP_956183]
Human Orthologue:
BRF1
Human Description:
BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) [So
Mouse Orthologue:
Brf1
Mouse Description:
BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) Gen

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa43418 Nonsense Mutation detected in F1 DNA Not yet available
sa37009 Nonsense Mutation detected in F1 DNA Not yet available
sa11693 Essential Splice Site Available for shipment Available now
sa9022 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3097
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035827 Nonsense 24 693 2 19

The following transcripts of ENSDARG00000005002 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 20974799)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21002966
GRCz11 20 20902639
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGGTGGATCGGACATCGACACAGATCCAGCCCGGGGGAGTGCAGTCTG[C/A]ACAGCCTGTGGTTCGGTTCTGGAGGAYAACATCATTGTGTCTGAGGTTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3103
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035827 Nonsense 188 693 7 19

The following transcripts of ENSDARG00000005002 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21009495)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21037662
GRCz11 20 20937335
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATTACAGATCTGTTGGTTTCTATTTTTAGATCCATGTCTGTACATTCCA[C/T]GATTCGCCCACATGTTGGAGTTTGGTGAAAAGACCCATGAGGTTTCGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43418
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035827 Nonsense 398 693 12 19

The following transcripts of ENSDARG00000005002 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21020184)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21048351
GRCz11 20 20948024
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCATAAGTCAGGTGCTTAACCGAAGAGACCAGGGAGGAAAGAAGGATT[T/A]AGATGGAAGAAAGAACACAGTCCCGCTTCCTAATCAGTCCAAACATGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37009
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035827 Nonsense 437 693 12 19

The following transcripts of ENSDARG00000005002 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21020300)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21048467
GRCz11 20 20948140
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGGCCCTCTGCCCAGTGCTGCCAGCCTTGGTTTAACAGACTCCATTAGA[C/T]AATGCATCACAGAGACAACAAATGGTGAGTGTGCCACTTAATGGTGCTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3068
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035827 Nonsense 484 693 14 19

The following transcripts of ENSDARG00000005002 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21050010)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21078177
GRCz11 20 20977850
KASP Assay ID:
554-2865.1 (used for ordering genotyping assays)
KASP Sequence:
ACATTTTGAATGAGATCGAGGTCGAGGCGAAGACAGAGCTGTGGATGAAA[C/T]AGAACGAGGAGTATTTGAGRGAACAGAAAGGTAAGCGAACAGTAGAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11693
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035827 Essential Splice Site 511 693 15 19

The following transcripts of ENSDARG00000005002 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21050454)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21078621
GRCz11 20 20978294
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGAGGAGAGAATTGCTAAAGARAAGGAACAGGGRACCTATAAGGAGAAG[G/A]TGAGTGTGTGTGTGNNTCTGGMTTTTTCTTACYATTTCKGCAGGAGCTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9022
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035827 Essential Splice Site 511 693 15 19

The following transcripts of ENSDARG00000005002 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21050454)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21078621
GRCz11 20 20978294
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGAGGAGAGAATTGCTAAAGARAAGGAACAGGGRACCTATAAGGAGAAG[G/A]TGAGTGTGTGTGTGNNTCTGGCTTTTTCTTACYATTTCKGCAGGAGCTTTAC
Associated Phenotype:
Not determined