Busch Lab

ZMP

cyp4

Ensembl ID:
ENSDARG00000004964
ZFIN ID:
ZDB-GENE-031219-3
Description:
cytochrome P450, family 4 [Source:RefSeq peptide;Acc:NP_954686]
Human Orthologues:
CYP4A11, CYP4A22, CYP4B1, CYP4X1, CYP4Z1
Human Descriptions:
cytochrome P450, family 4, subfamily A, polypeptide 11 [Source:HGNC Symbol;Acc:2642]
cytochrome P450, family 4, subfamily A, polypeptide 22 [Source:HGNC Symbol;Acc:20575]
cytochrome P450, family 4, subfamily B, polypeptide 1 [Source:HGNC Symbol;Acc:2644]
cytochrome P450, family 4, subfamily X, polypeptide 1 [Source:HGNC Symbol;Acc:20244]
cytochrome P450, family 4, subfamily Z, polypeptide 1 [Source:HGNC Symbol;Acc:20583]
Mouse Orthologues:
Cyp4a10, Cyp4a12a, Cyp4a12b, Cyp4a14, Cyp4a31, Cyp4a32, Cyp4b1, Cyp4x1
Mouse Descriptions:
cytochrome P450, family 4, subfamily a, polypeptide 10 Gene [Source:MGI Symbol;Acc:MGI:88611]
cytochrome P450, family 4, subfamily a, polypeptide 12B Gene [Source:MGI Symbol;Acc:MGI:3611747]
cytochrome P450, family 4, subfamily a, polypeptide 12a Gene [Source:MGI Symbol;Acc:MGI:88612]
cytochrome P450, family 4, subfamily a, polypeptide 14 Gene [Source:MGI Symbol;Acc:MGI:1096550]
cytochrome P450, family 4, subfamily a, polypeptide 31 Gene [Source:MGI Symbol;Acc:MGI:3028580]
cytochrome P450, family 4, subfamily a, polypeptide 32 Gene [Source:MGI Symbol;Acc:MGI:3717148]
cytochrome P450, family 4, subfamily b, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:103225]
cytochrome P450, family 4, subfamily x, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1932403]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28570
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013654 Nonsense 304 458 8 12
ENSDART00000076955 Nonsense 304 509 8 12
ENSDART00000131949 Nonsense 304 458 8 11

The following transcripts of ENSDARG00000004964 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 5574436)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4800989
GRCz11 16 4630278
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATTTTTGTGTGCCGCCCACAGGACGAGCATCAGCAGGGTTTGTCAGAC[G/T]AGGACATCAGAGCTGAAGTGGACACGTTCATGTTTGAGGGCCACGACACC
Associated Phenotype:
Not determined