Busch Lab

ZMP

si:dkey-18h19.2

Ensembl ID:
ENSDARG00000004958
ZFIN ID:
ZDB-GENE-091204-111
Description:
LOC402864 protein [Source:UniProtKB/TrEMBL;Acc:Q6PGZ1]
Human Orthologue:
KIAA1530
Human Description:
KIAA1530 [Source:HGNC Symbol;Acc:29304]
Mouse Orthologue:
4933407H18Rik
Mouse Description:
RIKEN cDNA 4933407H18 gene Gene [Source:MGI Symbol;Acc:MGI:1918351]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4554
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017898 Essential Splice Site 590 668 11 13
ENSDART00000121447 Essential Splice Site 590 721 11 14
ENSDART00000128353 Essential Splice Site 590 721 10 13

The following transcripts of ENSDARG00000004958 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 18986434)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14780887
GRCz11 14 15086450
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCACCAATGCCCAATGGATCTTTGTGTGAGCGTCAAGATAGAGTAAAGG[T/A]CAGAAAAACAACTGTACCAATGTCCTAATAAAAAATAACTATAATAATAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa631
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017898 Nonsense 626 668 12 13
ENSDART00000121447 Nonsense 626 721 12 14
ENSDART00000128353 Nonsense 626 721 11 13

The following transcripts of ENSDARG00000004958 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 18986165)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14780618
GRCz11 14 15086181
KASP Assay ID:
554-0541.1 (used for ordering genotyping assays)
KASP Sequence:
CTGAAGATGCAYTACGATTGGAGAGGGAGAAGAGGAAACGTGAGGAGGAG[C/T]AGCCAGGTTAGACAATTGATGCAACCTGTTTAACAATAATCTTTTGAATT
Associated Phenotype:
Not determined