Busch Lab

ZMP

grna

Ensembl ID:
ENSDARG00000004954
ZFIN ID:
ZDB-GENE-030131-8434
Description:
granulin-a [Source:RefSeq peptide;Acc:NP_001001949]
Human Orthologue:
GRN
Human Description:
granulin [Source:HGNC Symbol;Acc:4601]
Mouse Orthologue:
Grn
Mouse Description:
granulin Gene [Source:MGI Symbol;Acc:MGI:95832]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa33188 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38396 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6034 Nonsense Mutation detected in F1 DNA Not yet available
sa20026 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33188
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103523 Essential Splice Site 92 873 3 19
ENSDART00000137973 Essential Splice Site 92 1049 4 24
ENSDART00000147732 Essential Splice Site 92 873 4 20
Genomic Location (Zv9):
Chromosome 3 (position 30084140)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29802179
GRCz11 3 29933021
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAGCCATTGGCAGACAGGACACTAGCTAAAAAGCCAGACCTTCCCAAA[G/A]TGAGACATTATATAAAGAGTGTAAGTGATAGTACTCATAGCTGATCGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38396
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103523 Essential Splice Site 135 873 4 19
ENSDART00000137973 Essential Splice Site 135 1049 5 24
ENSDART00000147732 Essential Splice Site 135 873 5 20
Genomic Location (Zv9):
Chromosome 3 (position 30083931)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29801970
GRCz11 3 29932812
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTTGTCTGCTGATGTCTACATCATACGGCTGCTGTCCAGTAGCACAGG[T/A]AAGCGACACTATTACAGGAATATCAGCCCAAAACACCAGCTACTGCTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5206
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103523 Nonsense 162 873 5 19
ENSDART00000137973 Nonsense 162 1049 6 24
ENSDART00000147732 Nonsense 162 873 6 20
Genomic Location (Zv9):
Chromosome 3 (position 30082543)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29800582
GRCz11 3 29931424
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGCCCAAAYGACCATGAATGCAGTACTGACAGCAGCTTGTGTGTCAAG[C/T]GAAAAGGTATTGAGCAGAGTTAAGCCGGGCTAGAGATAGTAATGATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6034
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103523 Nonsense 716 873 17 19
ENSDART00000137973 Nonsense 892 1049 22 24
ENSDART00000147732 Nonsense 716 873 18 20
Genomic Location (Zv9):
Chromosome 3 (position 30068401)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29786440
GRCz11 3 29917282
KASP Assay ID:
554-3919.1 (used for ordering genotyping assays)
KASP Sequence:
AAAGCACACCAGCTCCAAAGTTGGATCTCGGCGTTGTTAAATGCGATGAA[C/T]AGTCGAGTTGCTCTGCAGATTCGACCTGCTGCCTCTTGTCTAAAGAMGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20026
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103523 Nonsense 846 873 19 19
ENSDART00000137973 Nonsense 1022 1049 24 24
ENSDART00000147732 Nonsense 846 873 20 20
Genomic Location (Zv9):
Chromosome 3 (position 30066460)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29784499
GRCz11 3 29915341
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCAACACTGCTGTCCCGCGGGGTATAAGTGTGGGCCGGGTGGCACCTG[T/A]ATTTCAGCCGGAGACTTGGACTGGAGCAACTGGGTCAACTGGAAGTTGTT
Associated Phenotype:
Not determined