Busch Lab

ZMP

mxb

Ensembl ID:
ENSDARG00000004953
ZFIN ID:
ZDB-GENE-030721-6
Description:
Interferon-induced GTP-binding protein MxB [Source:UniProtKB/Swiss-Prot;Acc:Q800G8]
Human Orthologues:
AC019294.4, MX1, MX2
Human Descriptions:
Putative UPF0621 protein C [Source:UniProtKB/Swiss-Prot;Acc:A8MV40]
myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) [Source:HGNC Symb
myxovirus (influenza virus) resistance 2 (mouse) [Source:HGNC Symbol;Acc:7533]
Mouse Orthologues:
Mx1, Mx2
Mouse Descriptions:
myxovirus (influenza virus) resistance 1 Gene [Source:MGI Symbol;Acc:MGI:97243]
myxovirus (influenza virus) resistance 2 Gene [Source:MGI Symbol;Acc:MGI:97244]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25518
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110696 Nonsense 367 627 8 12

The following transcripts of ENSDARG00000004953 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 6479176)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 6895913
GRCz11 1 7579346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGTGACACTCTCAACCTGACGACTGGAGAGGAGGTTAAATCCGCATCA[A/T]AACTGCTGATTTTTCCAGAACTTCGACAGGAATTTGCCTATTGGAATAGC
Associated Phenotype:
Not determined