Busch Lab

ZMP

rsad2

Ensembl ID:
ENSDARG00000004952
ZFIN ID:
ZDB-GENE-050913-129
Description:
Radical S-adenosyl methionine domain-containing protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q5RH95]
Human Orthologue:
RSAD2
Human Description:
radical S-adenosyl methionine domain containing 2 [Source:HGNC Symbol;Acc:30908]
Mouse Orthologue:
Rsad2
Mouse Description:
radical S-adenosyl methionine domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1929628]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa13259 Nonsense Available for shipment Available now
sa19183 Nonsense Mutation detected in F1 DNA Not yet available
sa13885 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13259
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019617 Nonsense 43 359 1 6
Genomic Location (Zv9):
Chromosome 17 (position 35528317)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 35413241
GRCz11 17 35361187
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGCGCTGTTGAGATGGCTCTCCATGCAGGTTTCTGGCGCACATGTGCAA[C/T]AAACTCCTGCTAGAAAGATCAGCCGCCCAGAGAGTCGCAMCAGTAAACAG
Long Flanking Sequence:
CAAAGCCTATAATAAAAATAATAATAATAATAATAATGATCGTTTTTGTTGTTATATTGTTGTTGTTGGCTATTTCACTGTTCAGAATGCTGAGACAAACCAAATATTGTAAATTCATATAATCATAAGCCTATAATATTATAAATGGCCTGCATGCTTTATGGGAGCGGCAGCCTATAATGAAAATTAAATGCATCAGGTGTCTATAAGAGAAATGAAACTCGTGCATAACAGCTGATAGTGTTTATCTTTCGTTTTCCGTCCCCCCGAGCAAGAAAAGAAACTGATCAGAGTGGCAACTTGACACTGCCCGGCCCCGTCCCGTATAAAAGAGGCGTGTGTTCTCCGGGCTTCAGAATCGACACATCTTCATCATGGTGACATCAAACCAACTTGGCTTTGCTAGACTGTTGATGCAGCTTTGTGTAAAGAACGTTCAAAGTTTCTTTTTAGCGCTGTTGAGATGGCTCTCCATGCAGGTTTCTGGCGCACATGTGCAA[C/T]AAACTCCTGCTAGAAAGATCAGCCGCCCAGAGAGTCGCACCAGTAAACAGAAAGAGGGATCCAGAGCTCCGTTCACAACTCCAAGCAGTGTAAACTACCATTTCACCCGGCAGTGCAATTACAAATGCGGCTTTTGTTTCCACACCGCGAAGACTTCTTTCGTCTTGCCTATTGAAGAAGCAAAGCGAGGCTTAAGACTGCTGAAAGAAGCAGGTAAACAACTTGTCTCTTAAAAGTGCAGGTGATTAGGGTACAACAAGTCAAATTAATATTAAGATAACCTATACGTTATAATTATAGCCATTTCCCCATGCAGCTGAATGATTACATTATGATTTGCAAACTCTTTCAAGCTTTTTTGAATAGCCAATGCAAATAAGGTGCTAATTTGCATACACTACTTTTATTATTTTTAATTTACGTAATCCAAAACATATGGATTAGGCGAAGTCAGGTTAAAAACTTTAATGTTAACATTGATGTTTTCTTCTTTTTTTCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4722
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019617 Nonsense 64 359 1 6
Genomic Location (Zv9):
Chromosome 17 (position 35528254)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 35413178
GRCz11 17 35361124
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAAGATCAGCCGCCCAGAGAGTCGCACCAGTAAACAGAAAGAGGGATCC[A/T]GAGCTCCGTTCACAACTCCAAGCAGTGTAAACTACCATTTCACCCGGCAR
Long Flanking Sequence:
TGTTGGCTATTTCACTGTTCAGAATGCTGAGACAAACCAAATATTGTAAATTCATATAATCATAAGCCTATAATATTATAAATGGCCTGCATGCTTTATGGGAGCGGCAGCCTATAATGAAAATTAAATGCATCAGGTGTCTATAAGAGAAATGAAACTCGTGCATAACAGCTGATAGTGTTTATCTTTCGTTTTCCGTCCCCCCGAGCAAGAAAAGAAACTGATCAGAGTGGCAACTTGACACTGCCCGGCCCCGTCCCGTATAAAAGAGGCGTGTGTTCTCCGGGCTTCAGAATCGACACATCTTCATCATGGTGACATCAAACCAACTTGGCTTTGCTAGACTGTTGATGCAGCTTTGTGTAAAGAACGTTCAAAGTTTCTTTTTAGCGCTGTTGAGATGGCTCTCCATGCAGGTTTCTGGCGCACATGTGCAACAAACTCCTGCTAGAAAGATCAGCCGCCCAGAGAGTCGCACCAGTAAACAGAAAGAGGGATCC[A/T]GAGCTCCGTTCACAACTCCAAGCAGTGTAAACTACCATTTCACCCGGCAGTGCAATTACAAATGCGGCTTTTGTTTCCACACCGCGAAGACTTCTTTCGTCTTGCCTATTGAAGAAGCAAAGCGAGGCTTAAGACTGCTGAAAGAAGCAGGTAAACAACTTGTCTCTTAAAAGTGCAGGTGATTAGGGTACAACAAGTCAAATTAATATTAAGATAACCTATACGTTATAATTATAGCCATTTCCCCATGCAGCTGAATGATTACATTATGATTTGCAAACTCTTTCAAGCTTTTTTGAATAGCCAATGCAAATAAGGTGCTAATTTGCATACACTACTTTTATTATTTTTAATTTACGTAATCCAAAACATATGGATTAGGCGAAGTCAGGTTAAAAACTTTAATGTTAACATTGATGTTTTCTTCTTTTTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTGACATAGTGCCATATATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19183
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019617 Nonsense 105 359 1 6
Genomic Location (Zv9):
Chromosome 17 (position 35528131)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 35413055
GRCz11 17 35361001
KASP Assay ID:
2261-1338.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTCCACACCGCGAAGACTTCTTTCGTCTTGCCTATTGAAGAAGCAAAG[C/T]GAGGCTTAAGACTGCTGAAAGAAGCAGGTAAACAACTTGTCTCTTAAAAG
Long Flanking Sequence:
TTAAATGCATCAGGTGTCTATAAGAGAAATGAAACTCGTGCATAACAGCTGATAGTGTTTATCTTTCGTTTTCCGTCCCCCCGAGCAAGAAAAGAAACTGATCAGAGTGGCAACTTGACACTGCCCGGCCCCGTCCCGTATAAAAGAGGCGTGTGTTCTCCGGGCTTCAGAATCGACACATCTTCATCATGGTGACATCAAACCAACTTGGCTTTGCTAGACTGTTGATGCAGCTTTGTGTAAAGAACGTTCAAAGTTTCTTTTTAGCGCTGTTGAGATGGCTCTCCATGCAGGTTTCTGGCGCACATGTGCAACAAACTCCTGCTAGAAAGATCAGCCGCCCAGAGAGTCGCACCAGTAAACAGAAAGAGGGATCCAGAGCTCCGTTCACAACTCCAAGCAGTGTAAACTACCATTTCACCCGGCAGTGCAATTACAAATGCGGCTTTTGTTTCCACACCGCGAAGACTTCTTTCGTCTTGCCTATTGAAGAAGCAAAG[C/T]GAGGCTTAAGACTGCTGAAAGAAGCAGGTAAACAACTTGTCTCTTAAAAGTGCAGGTGATTAGGGTACAACAAGTCAAATTAATATTAAGATAACCTATACGTTATAATTATAGCCATTTCCCCATGCAGCTGAATGATTACATTATGATTTGCAAACTCTTTCAAGCTTTTTTGAATAGCCAATGCAAATAAGGTGCTAATTTGCATACACTACTTTTATTATTTTTAATTTACGTAATCCAAAACATATGGATTAGGCGAAGTCAGGTTAAAAACTTTAATGTTAACATTGATGTTTTCTTCTTTTTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTGACATAGTGCCATATATCAGGCAAATTCTGTGCATAATAATGTTTACTTTATTGTACTTTTTGTTTAAGTATTTAAACATTTTATTATACAGGAATGGAAAAAATAAACTTTTCTGGAGGAGAACCCTTCGTTCATCAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13885
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019617 Essential Splice Site 168 359 2 6
Genomic Location (Zv9):
Chromosome 17 (position 35527517)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 35412441
GRCz11 17 35360387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGTTAGTAACGGCAGTCTGATCAGAGAAAGCTGGTTCCAGAAATACGG[T/A]AAGAATCTTTCATGGCCAGCAGAGGGCGGCAGAAGTTACTTGCAAACTTY
Long Flanking Sequence:
GCCATTTCCCCATGCAGCTGAATGATTACATTATGATTTGCAAACTCTTTCAAGCTTTTTTGAATAGCCAATGCAAATAAGGTGCTAATTTGCATACACTACTTTTATTATTTTTAATTTACGTAATCCAAAACATATGGATTAGGCGAAGTCAGGTTAAAAACTTTAATGTTAACATTGATGTTTTCTTCTTTTTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTGACATAGTGCCATATATCAGGCAAATTCTGTGCATAATAATGTTTACTTTATTGTACTTTTTGTTTAAGTATTTAAACATTTTATTATACAGGAATGGAAAAAATAAACTTTTCTGGAGGAGAACCCTTCGTTCATCAGAAAGGCAGTTTTCTGGGAGAGCTGGTGCTGTACTGTAAGCAGGAGCTGCAGCTGCCGAGTGTCAGCATTGTTAGTAACGGCAGTCTGATCAGAGAAAGCTGGTTCCAGAAATACGG[T/A]AAGAATCTTTCATGGCCAGCAGAGGGCGGCAGAAGTTACTTGCAAACTTTTAACACAATTCACCCCATTGTAGTTCATAACAGTGTTTAGCTAGCTTCACAAAATAGTTAGATCTGCTTAAAAAAAATTAATAAGCTCCATTTAATAGCCGAATTTAAGAATTTGTTGTCATTTGAGATAAGCATTGCATTGTACTGTCAATTCCCTTATGAAAAATGAACAAAGCATTATATAGTTAACGTATAGTAACCATGTTTTTAGCAAATTAATTGCCTTTTGAATTACATCATACATCATGATTTTTTTTATACAATTCATATTTAATTTAATCTTATTTAGATTTTTATGTCTTTCCTTTAAACATTTTCACAGAAACTGGTCAACATTTAAACCTCTCTAAAATGTTTGTATTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
Associated Phenotype:
Not determined