Busch Lab

ZMP

mtdhb

Ensembl ID:
ENSDARG00000004939
ZFIN ID:
ZDB-GENE-090929-2
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B1H1H8]
Human Orthologue:
MTDH
Human Description:
metadherin [Source:HGNC Symbol;Acc:29608]
Mouse Orthologue:
Mtdh
Mouse Description:
metadherin Gene [Source:MGI Symbol;Acc:MGI:1914404]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa28728 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa28728
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015170 Essential Splice Site 143 525 3 13
ENSDART00000075937 Essential Splice Site 143 414 3 9
ENSDART00000125369 None None 504 None 14
Genomic Location (Zv9):
Chromosome 16 (position 44489983)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41770491
GRCz11 16 41720523
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACGCAAAAATGTAAATGGTTATTCATTCATACTGATTCCTTTTGACTGT[A/G]GGGAAAGAAGAATAAGAAAAAGACAAAAGCTTCTGCAAAAGAGAAAAAAT
Long Flanking Sequence:
TCCTGGGCAAACTCCCTCCATGTGCCCTTACCCATCATGCCCTCCCAATCATCCCCATCCACAAAATTGGCTGAATCACTGTCTCTCCACTCCACCAATAGCTAGTGTGTAGGGAGCGCACTTGTCCTGTGGCTGCCGTCGCATCATCCAAGTAGATGCTGCACACTGCACCCCCCATAATTGTGAAGTGCTCTGGATGCATGGCCATACATGATAAATGCGCTGTATAAATAAAAATACATACATTGCATTACATTGATACCCGTCCTATTGCCTTTCCTTTAAAAAGTTTGTTTTTGAAATGTCTCACAGAAAGCACAGAGGAATGGACTTGCTGTTGAACCACAGGAGGAGGTTAAAACGGCAGACGATCAAGAACTAGCAGAAGTGAGGGCTGACAAGGTAATAAAATGCCCTGCTTCATTTTCTTTGACATTTAAAAGGATAATTCACGCAAAAATGTAAATGGTTATTCATTCATACTGATTCCTTTTGACTGT[A/G]GGGAAAGAAGAATAAGAAAAAGACAAAAGCTTCTGCAAAAGAGAAAAAATCCTCCACATCTGTTGACGGCAAAGAGCCTGATGAAGGTACGTTATGAAATTTGATTAATACGATTCCTACACTTCATAAATAGTTAACAGAATTAATAGAGATCAAATACCTATTATTAGATAAGTAACTGATTGTGTATTTGTTTTTTTTTTTACATACTCGTTGAATATACTGTACTTTATTTACTTTGCAAAAAATGTGTGTAATTTAGCTAATTAAAATGTTTCTCATTGTAACAGTAATGTTTTTTGTTACCCAAAAAAAAGCACAAATTGTCAGCATATTAGAGCATAATTATTTGATGATATGCAATTTTAACTATAGGATTTAGTGTGCTCACTTTTTATTTAATATATTTCATGATCAGGATATGCAGGTTTCATTTTGTCATAATTTGACTTTGTTAGTTACTTTAAACTTTAGACACCTTCCTTTTAATATCCTCTTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28729
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015170 Nonsense 411 525 10 13
ENSDART00000075937 Nonsense 393 414 9 9
ENSDART00000125369 Nonsense 414 504 10 14
Genomic Location (Zv9):
Chromosome 16 (position 44499873)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41780381
GRCz11 16 41730413
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTTATTTACCTGGATGTTTTTTCCATTTGTCAGGAATCTGATGATGAC[A/T]AGGATAAAGATGAATCTGGCACCCCTGGTAGCGGTAAAGCTAAGAAGAAG
Long Flanking Sequence:
GATTGTCACTCACATGCACGAGCACCGATTTGCCTGTGATTTCAGGCATTTGTCTGCGATTTCTCAAAACCTGTCGGCGAGTCAAAATCGGGGCTGAAATCATGCAGTCTGAACTAGGCATTAATTAATATAATTCAAAGCAAAATTTTTTTGAGAAAATTCCCCTTTTATTGTAGATGTATTGTAATTCAGTTTGGGATATATTTGGCCCACAGCCCTCAATCTAGTTTGGTTTTTATAGGAAAAACTTTGGGCCCCTGCTTCAAAACGATTTAAGATGCTGATGACCGTTAAACATGTCATATTGGCATTGTGAAACGGGTCCATATTATTAAATGTAATGTTTTCATAAATATATACTTACAAACTTTAAAACTAAATTGTTTAAATAACACAAATCTAAAATTGCAAAAATGTAACATTAAAAAACAATCTAGAATTGTAAAATATTATTTATTTACCTGGATGTTTTTTCCATTTGTCAGGAATCTGATGATGAC[A/T]AGGATAAAGATGAATCTGGCACCCCTGGTAGCGGTAAAGCTAAGAAGAAGAAAAAGAAGAAGAAGAAGCTTGAGGACGCTGGACCTTCTGCTCAGGTGAGATATAGATTACCAGAAATTATATTGAAAAGAACAACTGATCTTTTTCGGTGAATATAATGGAGAATCTGTGTTTGATTCAGCCACAGGTGAAGGCAGAAAGCATTGTGACTCTGACACCGAGCGCAACAGTAAACATCCCAGCTGCCACAGCAGGGGTGAGCGCTCCATTTTTAAATATTCATCTAGCTGTTTGCTACAAAATGAGATGCTAAAGTTGTCATGTCTGCAGGCACGTGTTGAAGATGCTCCACGTGTCGCACCATCAGCCCCAGTACAGACTCAACAGAGAAAGAGTGGACCTGAGCCGACCGACAAATCCAAACCTGCTCCAACACAGAGTATGTTCCATCATCACGCAGAACAACTAGCAGTGTTTACATTTATTTGGTAGTGATTCTT
Associated Phenotype:
Not determined