Busch Lab

ZMP

Q568T9_DANRE

Ensembl ID:
ENSDARG00000004917
Description:
LOC553360 protein [Source:UniProtKB/TrEMBL;Acc:Q568T9]
Human Orthologue:
PCIF1
Human Description:
PDX1 C-terminal inhibiting factor 1 [Source:HGNC Symbol;Acc:16200]
Mouse Orthologue:
Pcif1
Mouse Description:
PDX1 C-terminal inhibiting factor 1 Gene [Source:MGI Symbol;Acc:MGI:2443858]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa40806 Nonsense Mutation detected in F1 DNA Not yet available
sa2316 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26848
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009197 Nonsense 24 721 1 16
ENSDART00000051904 Nonsense 24 287 2 8
Genomic Location (Zv9):
Chromosome 6 (position 55624063)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55337733
GRCz11 6 55347546
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAATTAAGGCAGACTCGGCATTGGTCATGTCGCCCACCGGGTCCACGT[C/A]ACAGGCGGCTCCGTTCTCACCCTCGACCAGCAAACCCATCCAAGAGCTGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1816
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009197 Splice Site None 721 None 16
ENSDART00000051904 Splice Site None 287 None 8
Genomic Location (Zv9):
Chromosome 6 (position 55625815)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55335981
GRCz11 6 55345794
KASP Assay ID:
554-1808.1 (used for ordering genotyping assays)
KASP Sequence:
GTTAAAAGAACATAGTGTAGTGAACAATGTTTCTGAATTCGTTTTGATTT[C/A]AGGTTGAGATTCCAGCCACTCCAACAACTCCCACTGTCCCCATTTCTCCC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa40806
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009197 Nonsense 162 721 4 16
ENSDART00000051904 Nonsense 162 287 5 8
Genomic Location (Zv9):
Chromosome 6 (position 55625914)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55335882
GRCz11 6 55345695
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGTACACCAGGAGTAAAACCTTGGGTTAACACCACCACAGATGAGAAA[C/T]AAGGCCAGGCCAGTACGCCTGCACCTGCACCGTACCGGCCCTCTGTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2316
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009197 Nonsense 249 721 6 16
ENSDART00000051904 Nonsense 249 287 7 8
Genomic Location (Zv9):
Chromosome 6 (position 55629955)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55331841
GRCz11 6 55341654
KASP Assay ID:
554-3204.1 (used for ordering genotyping assays)
KASP Sequence:
CCCCACGGGAATCCTTCAACCGCTGGCTTCTGGAGAGGAAAGTAGTGGAT[A/T]AAGGTCTGGATCCTCTCCTGCCCAGTGAATGTGACCCAGTCATCTCTCCG
Associated Phenotype:
Not determined