Busch Lab

ZMP

gys2

Ensembl ID:
ENSDARG00000004904
ZFIN ID:
ZDB-GENE-030826-31
Description:
glycogen [Source:RefSeq peptide;Acc:NP_001018199]
Human Orthologue:
GYS2
Human Description:
glycogen synthase 2 (liver) [Source:HGNC Symbol;Acc:4707]
Mouse Orthologue:
Gys2
Mouse Description:
glycogen synthase 2 Gene [Source:MGI Symbol;Acc:MGI:2385254]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa20248 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa920
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014007 Essential Splice Site 517 701 12 16
Genomic Location (Zv9):
Chromosome 4 (position 15873042)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16815882
GRCz11 4 16804858
KASP Assay ID:
554-0826.1 (used for ordering genotyping assays)
KASP Sequence:
CCACCTGGGAGTGTTCCCATCCTACTAYGAACCATGGGGCTACACACCAG[G/A]TTTCATATTCATATGCTCATTCACACTGTAGTAGCAKTCACATCTTTAAT
Long Flanking Sequence:
GCTTGGTTTGAACTTCATGCCTACATGCACTAAGGTGCTTCCATGTGATGATTGGCTAATTACATGAAGTAATTTGGAGTTGTACCTAATAAAGTGGCCACTTTACAATCCGCTTTTGTCCAGTAAGCATGGTGATGTTTAAAACCACATAATTCATATTCAAAAAAGTTCTGTTTTTTACATGCATAAAAACCAAGCCTCAGCTCCATCTACTTGGCTCCAGCTCATTATTACACATAATCCCAGAACGTCCATGTAAAAGCCGTTGTTGTCATCAGTTAAGTGCTTTGCCTAATGCATAAAAGATGTCTAATATTGATTATTTGTGGTGAGCCATACATAAAGGTGTGGTGTGAATGTGTTTCTACACCAGATTGTGTTTCATCCCGAGTTCCTGTCCTCCACCAGCCCCCTGCTGCCAATGGACTATGAGGAGTTTGTGCGCGGCTGCCACCTGGGAGTGTTCCCATCCTACTATGAACCATGGGGCTACACACCAG[G/A]TTTCATATTCATATGCTCATTCACACTGTAGTAGCATTCACATCTTTAATTCTTTCTCATTCTAGCAACGTTTTGACACATTTTATGCATATGGTTCAATTTTGTCATTTAATATTTGAACAATTTAAAATCCCGGACGAGCCCCCCATTTATATTATAGCCACTTATACAGTTCAAGCTTGTTGTAAGAGGAGAATCAGGTAAATGCTGATATTAAATTGTGATGGTAGCATGTTCAAGTTTATAAATGTTGACACATTAATCATCATATGTGTTCAGGTGAGTGCACAGTCATGGGAATCCCCAGTGTGACCACAAATCTATCTGGGTTTGGCTGTTTCATGGAGGAACATGTTTCTGACCCGTCTGAATATGGTGAGTGAATCACTGGCTGAATCACTGCTTCCCAAAGCCATTTGCATTATCAACATGTGAAGTTTATTTATAAACTACTTTCTAGAGCACAGGTGTCAAACTCAGTTCCAAAAGGGCCGCAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20248
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014007 Nonsense 610 701 15 16
Genomic Location (Zv9):
Chromosome 4 (position 15870919)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16813759
GRCz11 4 16802735
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCTTAATGTGGTAAAGTGTTTCTTTCTGCTCAGTTCTACATGCACGCC[A/T]GACATTTGGCCCTCAGCAGATCCTTCCCTGAGAAATTCCGACCGGAGCAT
Long Flanking Sequence:
TCATTGTATCGTCAGCAAATTCAAGGAAAAAATATTTTAAGTAAAATCTTGATGATATTTTATGTAAACATCAGAGAATAAAACAAAAAAAAGACCCCTTTAAACTTTAATAGGATAAAGAAAACACTGAAGTGTTACTTGGGGGTTTATAACAAGACCTTTGTTTCAGTAAAGTTCATAGTTCATAAAGTTCATAGTTCTTAATATGCCTGGTAAAGATAATAATCTCAATAACATCTGTGTTTCAGGAATCTACATCGTGGACCGGCGGTTTCGCTCTGCGGACGAGTCGTGTAATCAGCTGACCCAGTTCATGTTTTCATTCTGCCAGAAGTCGCGCAGGCAGAGAATAATCCAGCGTAACCGAACGGAGAGACTCTCTGATCTGCTGGACTGGAGATATCTTGGACGAGTGAGTGTCTTTTAGGTGATCGGTGCAGTTTTACTCCTCTGCTTAATGTGGTAAAGTGTTTCTTTCTGCTCAGTTCTACATGCACGCC[A/T]GACATTTGGCCCTCAGCAGATCCTTCCCTGAGAAATTCCGACCGGAGCATCTAAACCTTACGTCGGTGAGACGCCTTATACATCTCAATCTGTCTCTGAAGGCGGGCAAATGAATAAATATAATACATGCCTCCTACAGTATTTATTCAAGTCCTAAAGCATCAAAAAGTTTGGATGCTTTTGAGGAGTAATTTGACTCTACATTTGTCAAAAACATACCTTTAATCTTTGATTTGGCAACAAATATCAGAAACAACATAAATAATTTCACTTTATTGCTTGAAAAATCCACAAAATGTTTTATATTTTTTGCAAGTTTCATGTTTATTGTATTAAAAAATGTTTATAATGAATCAAAACACTACAAAAATATAATTAGAAACTACAAATAATGTCAGTTTTACAATGAAAATACAAATAAATATTAATGACACTAAAAAGCGTTGTTGGAATAGAATTAATCTTATTTAAAAATATATTATTTTTGTTATTATACTTAC
Associated Phenotype:
Not determined