Busch Lab

ZMP

rock2b

Ensembl ID:
ENSDARG00000004877
ZFIN ID:
ZDB-GENE-060125-2
Description:
rho-associated, coiled-coil containing protein kinase 2b [Source:RefSeq peptide;Acc:NP_001087216]
Human Orthologues:
ROCK1, ROCK2
Human Descriptions:
Rho-associated, coiled-coil containing protein kinase 1 [Source:HGNC Symbol;Acc:10251]
Rho-associated, coiled-coil containing protein kinase 2 [Source:HGNC Symbol;Acc:10252]
Mouse Orthologues:
Rock1, Rock2
Mouse Descriptions:
Rho-associated coiled-coil containing protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:107927]
Rho-associated coiled-coil containing protein kinase 2 Gene [Source:MGI Symbol;Acc:MGI:107926]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa23749 Nonsense Available for shipment Available now
sa29396 Nonsense Mutation detected in F1 DNA Not yet available
sa23748 Nonsense Available for shipment Available now
sa17708 Nonsense Available for shipment Available now
sa43481 Nonsense Mutation detected in F1 DNA Not yet available
sa43480 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23749
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002777 Nonsense 277 1387 6 34
ENSDART00000097823 None None 264 None 6
ENSDART00000137837 Nonsense 271 1401 6 31
ENSDART00000147168 None None 245 None 6
ENSDART00000002777 Nonsense 277 1387 6 34
ENSDART00000097823 None None 264 None 6
ENSDART00000137837 Nonsense 271 1401 6 31
ENSDART00000147168 None None 245 None 6
Genomic Location (Zv9):
Chromosome 20 (position 33711175)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33783688
GRCz11 20 33686567
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTTATTACGGTCGCGAGTGTGACTGGTGGTCTGTTGGTGTTTTTATTTA[T/G]GAGCTTCTAGTGGGTGAGTAGTGTCAGCTTCATATGCATCTCTTGTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29396
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002777 Nonsense 277 1387 6 34
ENSDART00000097823 None None 264 None 6
ENSDART00000137837 Nonsense 271 1401 6 31
ENSDART00000147168 None None 245 None 6
ENSDART00000002777 Nonsense 277 1387 6 34
ENSDART00000097823 None None 264 None 6
ENSDART00000137837 Nonsense 271 1401 6 31
ENSDART00000147168 None None 245 None 6
Genomic Location (Zv9):
Chromosome 20 (position 33711175)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33783688
GRCz11 20 33686567
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTTATTACGGTCGCGAGTGTGACTGGTGGTCTGTTGGTGTTTTTATTTA[T/G]GAGCTTCTAGTGGGTGAGTAGTGTCAGCTTCATATGCATCTCTTGTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23748
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002777 Nonsense 506 1387 13 34
ENSDART00000097823 None None 264 None 6
ENSDART00000137837 Nonsense 500 1401 13 31
ENSDART00000147168 Nonsense 200 245 5 6
Genomic Location (Zv9):
Chromosome 20 (position 33694606)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33767119
GRCz11 20 33669998
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGAAGACAACCTGAGATCCCTGGAGAAAGAGAAAGTTTTACTGAAACAC[C/T]AGCGTACACAGAGCGTAAGAAAAGCTGGTCTAGAGACCGACAGAAAACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17708
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002777 Nonsense 627 1387 15 34
ENSDART00000097823 None None 264 None 6
ENSDART00000137837 Nonsense 621 1401 15 31
ENSDART00000147168 None None 245 None 6
Genomic Location (Zv9):
Chromosome 20 (position 33693285)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33765798
GRCz11 20 33668677
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTGGAGCAGGACAAACTCAGCCTGCAGACCTCGCTRGAGCTRGAGAAA[C/T]GAGAGARAAACGCCGGCTCAGAGACCATCACTGACCTGCAGGGTGAGCAK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43481
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002777 Nonsense 846 1387 23 34
ENSDART00000097823 None None 264 None 6
ENSDART00000137837 Nonsense 840 1401 20 31
ENSDART00000147168 None None 245 None 6
Genomic Location (Zv9):
Chromosome 20 (position 33685407)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33757920
GRCz11 20 33660799
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTACATATCTGCAATAAAAATGTCTTTTCTTTGCATCCAATCAGGGAA[C/T]GAGAAGAATCTGAAAAACAGCTGAAGGAGATGAAGGACCAGCTGGAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43480
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002777 Nonsense 1145 1387 29 34
ENSDART00000097823 None None 264 None 6
ENSDART00000137837 Nonsense 1138 1401 26 31
ENSDART00000147168 None None 245 None 6
Genomic Location (Zv9):
Chromosome 20 (position 33680733)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33753246
GRCz11 20 33656125
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCACCAGCATCAGCAGCATCGGCAATGACCTGGATTCTGACGAGGCATA[T/A]CCAGGTAACACTGCAGGTTATGACATATTATTAGCAGTGTAAAGATCAGT
Associated Phenotype:
Not determined