Busch Lab

ZMP

zgc:171734

Ensembl ID:
ENSDARG00000004864
ZFIN ID:
ZDB-GENE-070928-26
Description:
forkhead box protein R1 [Source:RefSeq peptide;Acc:NP_001096594]
Human Orthologues:
FOXR1, FOXR2
Human Descriptions:
forkhead box R1 [Source:HGNC Symbol;Acc:29980]
forkhead box R2 [Source:HGNC Symbol;Acc:30469]
Mouse Orthologues:
Foxr1, Foxr2
Mouse Descriptions:
forkhead box R1 Gene [Source:MGI Symbol;Acc:MGI:2685961]
forkhead box R2 Gene [Source:MGI Symbol;Acc:MGI:3511682]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40575 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30620 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40575
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019561 Essential Splice Site 146 321 4 6
Genomic Location (Zv9):
Chromosome 5 (position 60151212)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58012830
GRCz11 5 58682539
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGAATGACAGTGTAGCTAGTCTATAATGCATCCCCACTATGTCACCTC[A/G]GCTGACAGATGAAGATGACGCTTCGTCTGTGGATGTGCCAATCTGCCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30620
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019561 Essential Splice Site 235 321 4 6
Genomic Location (Zv9):
Chromosome 5 (position 60151483)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58013101
GRCz11 5 58682810
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGCCGCAGCGGCAGTCTCAACGTTCAGCAGATCTACAACTTCACCAG[G/A]TCTCCGAGCGCTCCATACACAAACACACACATATGCTTACACATAAACAC
Associated Phenotype:
Not determined