Busch Lab

ZMP

hinfp

Ensembl ID:
ENSDARG00000004851
ZFIN ID:
ZDB-GENE-040426-2764
Description:
histone H4 transcription factor [Source:RefSeq peptide;Acc:NP_998589]
Human Orthologue:
HINFP
Human Description:
histone H4 transcription factor [Source:HGNC Symbol;Acc:17850]
Mouse Orthologue:
Hinfp
Mouse Description:
histone H4 transcription factor Gene [Source:MGI Symbol;Acc:MGI:2429620]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa14918 Nonsense Available for shipment Available now
sa33629 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6984
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051414 Essential Splice Site 165 487 3 9
ENSDART00000124487 Essential Splice Site 165 487 4 10
Genomic Location (Zv9):
Chromosome 5 (position 32239164)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29999994
GRCz11 5 30600147
KASP Assay ID:
554-5259.1 (used for ordering genotyping assays)
KASP Sequence:
CAATGTCTAGAGGCCAACGAAGAGAATGTGTTATTTTGTGGCTGGAAAGG[T/G]AATAAATGAGTATTGTTAYTKAAATGTTTTGCAGAACATKAACATGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14918
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051414 Nonsense 247 487 6 9
ENSDART00000124487 Nonsense 247 487 7 10
Genomic Location (Zv9):
Chromosome 5 (position 32241347)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30002177
GRCz11 5 30602330
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTARTGANTGTTTTTMCCTGTTCTCNTGATTAAAGTCAACCATTATAAATG[T/A]CCACTATGCGAAAKGACCTGTCCATCGCCGTCCTCRTTGAGAAACCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33629
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051414 Nonsense 354 487 8 9
ENSDART00000124487 Nonsense 354 487 9 10
Genomic Location (Zv9):
Chromosome 5 (position 32242951)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30003781
GRCz11 5 30603934
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATGTTTGTGAGCAGTGTTTCACCCGAGGGAATAACCTCACAGCCCACT[T/A]ACGCAAGAGACATCAGTTCAAATGGCCTTCAGGACATCCCAGGTTCAGGT
Associated Phenotype:
Not determined