Busch Lab

ZMP

foxp1a

Ensembl ID:
ENSDARG00000004843
ZFIN ID:
ZDB-GENE-060929-624
Description:
forkhead box P1a [Source:RefSeq peptide;Acc:NP_001071032]
Human Orthologue:
FOXP1
Human Description:
forkhead box P1 [Source:HGNC Symbol;Acc:3823]
Mouse Orthologue:
Foxp1
Mouse Description:
forkhead box P1 Gene [Source:MGI Symbol;Acc:MGI:1914004]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29883
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104985 Nonsense 110 433 4 11
ENSDART00000121544 Nonsense 110 638 3 16
ENSDART00000129022 Nonsense 110 637 4 17
ENSDART00000146526 Nonsense 77 162 3 5

The following transcripts of ENSDARG00000004843 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 10778310)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 10737112
GRCz11 23 10672082
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCTCAGCAGATGCAGCAGATCCTCCAACAGCAGGTCCTGAGCCCTCAG[C/T]AGCTCCAACTGCTACTGCAGCAACAGCAGGCCCTCATGATACAGCAGGTA
Associated Phenotype:
Not determined