Busch Lab

ZMP

cops2

Ensembl ID:
ENSDARG00000004785
ZFIN ID:
ZDB-GENE-040625-15
Description:
COP9 signalosome complex subunit 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6IQT4]
Human Orthologue:
COPS2
Human Description:
COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) [Source:HGNC Symbol;Acc:30747]
Mouse Orthologue:
Cops2
Mouse Description:
COP9 (constitutive photomorphogenic) homolog, subunit 2 (Arabidopsis thaliana) Gene [Source:MGI Symb

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa12873 Essential Splice Site, Missense Available for shipment Available now
sa38113 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16281 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12873
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006124 Essential Splice Site 124 443 None 13
ENSDART00000133872 Missense 125 282 4 8
Genomic Location (Zv9):
Chromosome 25 (position 33356491)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31966893
GRCz11 25 32377850
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAGAAATCCATYAACTCCATTTTAGACTATATCTCAACCTCCAAACAGG[T/C]AATGGTATGTTTTACATTGCTGTGTGAGTTTGCATTKYATTCAGTTTCAT
Long Flanking Sequence:
ATAATGCTGCTGATATGATTTTAAAGCATAAATAACTGCATTTTAACTTAGAAAATGAATAATCACCTTCTTTTTGTTTTGCAGGTGCTGGAATTGGAGGGTGAGAAAGGAGAATGGGGATTCAAAGCACTGAAACAAATGATCAAGATCAACTTCAAACTGGTATGTAGTTATATAGTTTATTATAGTATAAAGTATTATTTGTTTGTTCGCCTAAAACATTATGAATATGAAATAAAATTGGGTAATGTCATAAAAAGATTCTATATCTGTTTGATAGTTTTTTTTTCATTTCTCAACCAATTATATATATAAGAATTATTGATCTGTTTGGAAATGACGTTGATTCATTTATTTTCTTCTGATTTCATAGACTAATTTTCCTGAAATGATGAACCGGTACAAACAGCTTTTGACTTATATTAGGAGCGCTGTCACCAGAAATTATTCTGAGAAATCCATCAACTCCATTTTAGACTATATCTCAACCTCCAAACAGG[T/C]AATGGTATGTTTTACATTGCTGTGTGAGTTTGCATTTCATTCAGTTTCATTACATTATCAACCCTCGTAATACATTCAAGTCCTGTAAGAAGTGCATTATAGTTTTAAACTAATAAAGAATCTAAAAGAATTATTATTATTATTATTAATATTATTATTATTAAGGAATTATTATTATAATAACAAGGTGATGCAGTGGCGCAGTAGGTATTGCTGCCGCCTCACAGCAAGAAGGTCGCTGGGTCGCTGGTTCGATCCTCGGCTCAGTAGGTGTTTCTGTGTGGAGTTTGCATGTTCTCCCTGCGTTCACGGGGGTTTCCTCCGGGTGCTCCGGTTTCCCCCACAACCCAAAGACATGCGGTACAGGTGAATTGTGTAGGCTAAATTGTCCGTAGTGTATGAGTGTGTGTGTGAATGTGTGTGTGTGGATGTTTCCCAGAGATGGGTTGCGGCTGGAAGGGCATCCGCTGCGTAAAAAATGTGCTGGATAAGTTGGCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38113
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006124 Essential Splice Site 180 443 6 13
ENSDART00000133872 Essential Splice Site 182 282 6 8
Genomic Location (Zv9):
Chromosome 25 (position 33353578)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31963980
GRCz11 25 32374937
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTTGGAAAACTTCAGAAGATTCTCAGGCAATTACATCAGTCGTGTCAG[G/A]TATAGTAAATGATCTAAATAGAAAAATAGCATTCATAAAAGGTGCTGCAA
Long Flanking Sequence:
TTCTGTTGATTCCTAATAATTATAGTAATACAAGCAAATGTTACCGCTCCATTCACACGGGGCTTCAGCGTCAACGATTGACTGAAGGCGTGTCTGAAGTTGGGGCTGAAGCAATCGTCATAGAAGCGTCAGCCAATGAAATTCAGCAATAGGCCACTGTCTAGCTGGTGTATTTGCATACAGCGATCTGATTGGCTGACGCTTCCGTTGGAGCTTGAAAAGTTGAGCTAGTCGCAACTTCTGCAGCGAGCAACCCCTCTGAAGCGGCGCCGATGGATCCCCAATGCAGTTCGGCAACGCCTGACGTCACCCATTCAAAGTGAATGAGAAGCGTTGATGCTGACGCCCCTTGTGAATGGGGCGTAAGAGTCTGTGTCAATACTCACTTTTAAGACTATTGCAAACCTCTCTGTTTCATGCAGCTGGGAAAGTTGTACCTGGAAAGAGAAGAATTTGGAAAACTTCAGAAGATTCTCAGGCAATTACATCAGTCGTGTCAG[G/A]TATAGTAAATGATCTAAATAGAAAAATAGCATTCATAAAAGGTGCTGCAAATATCTGAAAGTGGTCGATGTTGTTGGTTTAGACGGATGACGGAGAGGATGACTTGAAGAAGGGCACTCAGCTTTTGGAGATTTACGCTTTGGAGATCCAGATGTACACGGCACAGAAAAACAACAAGAAGCTCAAAGCCCTTTATGAGCAGTCATTACACATCAAATCAGCCATCCCACATCCACTCATCATGGGAGTCATCAGAGGTGTGTTGCATGTTTTTAGTCTAAATTGTTTAATTGCTTCTCAAAGGTTTATTTGTTTTTTTGTTTAATTTTCTTTTGTAATTCAGATTTGTGTCTGCGTGTCTCAGATTTGGTTTGTCTTGTTTTGTGCACGATTAACAAGTCCTCTAATTCTGCTTGGTTTTGTTTTTTGTTTTTTTGCATGATTAGAATGTGATTTAGTTTTGTTTTTGTTTATTTTTTGATTTGTTTAATTTTAGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16281
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006124 Nonsense 273 443 8 13
ENSDART00000133872 Nonsense 275 282 8 8
Genomic Location (Zv9):
Chromosome 25 (position 33351129)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31961531
GRCz11 25 32372488
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGACTTTTTTGAAGCGTTCAAAAACTAYGATGAGTCYGGAARCCCCAGA[C/T]GAACCACTTGTCTGAAGTACCTGGTCCTGGCCAACATGYTRATGAAGTCT
Long Flanking Sequence:
TGGTTTGTTTTGTGCACCCTTGCAAAGTTGTTTTTCTTTAGTTTGTTTGTTTTTGTACAGTTGTTTTGTTTTATTTTTTAGTGTGTTTTTATTTGGTTTTTGTGGGCGTGTAATTGGAAAAGTGTTTTTTGTTTTAGTTATTCTTGTGCATTTAGTTGTTTTTTGCTAAAATTGAAAGTTTGCTTTCGGGTTTTGTTTTTGCTTTTTGGCTTGGTTTGTGTACAGTTGTAATATCTTTATTTCTATCAGAAAGTTTGTTTGCTTTTTTTTTTATTTACAATTTATTGACAGTTGTTGTTTTTTTCATTGGTGCGGTTTAGTCGCAAAGTTGGCTCATTATTTTATTTTTTATACAGCTTGTCTACTAATCATCTTTAACTTGTGGCTTGTTCTCTACAGAGTGCGGCGGTAAAATGCACCTGAGAGAAGGAGAGTTCGAGAAGGCACATACAGACTTTTTTGAAGCGTTCAAAAACTACGATGAGTCCGGAAGCCCCAGA[C/T]GAACCACTTGTCTGAAGTACCTGGTCCTGGCCAACATGCTGATGAAGTCTGGAATCAACCCGTTTGATTCTCAAGAGGTACGGCTGCACAAAATATCGTTTCTGCATCGATATCGCAATGTTCACACCCATAAAGTCATATAGCAGGATGTGCAATGTTGAGTTGGGATTATATTTGGTCAGCACTGCAGTTCAGAACACATGAGATTTGTGGAGTCACTGTAGAGTTTATCCATAATATACAGGGCTTGGACAATGAAACTGAAATGTCTGGTTTTAGACCACAATAATTCATTAGTATGATGTAGGGGCTCCTTTTGCGGCCAGTACAGCATCAGTTCTTCGATTTTGAGCCATTGTTCTTGCAGAATAGTGGCCAGGTCACTATGTGATGCTAATGGAGAAAAATGTTTCCTGACTCGCTCCTCCAAAACACCCCAAAGTCACTCAATAATATATAGATCTGGTGACTGTGCAGGCCATGGGAGATGCTCAACTTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4302
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006124 Nonsense 420 443 13 13
ENSDART00000133872 None None 282 None 8
Genomic Location (Zv9):
Chromosome 25 (position 33345391)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31955793
GRCz11 25 32366750
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCAAGTCAATCAGCTGTTGGAGCTCGATCACCAGAAAAGAGGCGGAGCC[C/T]GATACACGGCTCWGGACAAATGGACCAATCAGCTGAACTCTCTCAATCAG
Long Flanking Sequence:
TTAATTACTTGCTTATTTATGTATTTTTTTTACTTGTTTCCTTGCTTGTTTATTTTATTTGTTTATTTACTTAATTTATGCCTATTTATTTTTGTATTCATTTACTTATGTTTATTTACTTATTTGCATATTTATTTTTAATTACTTGTTCATTTACTTGCTTATTTATTTGTATTTACTTAACTATTTGCTTGTTTATGTTTTTTTACTTATTTGCTTGCAGGTTTATTTACTTGCTTATTTACTTAATTTATGCATATTTATTTTGTATTTATGTACTTGTTTATTTACTTTTTTATTTGCATATTTTGTATTTTTTTTTATTTAATTACTTGTTTATTTTATTTGTATTTACTTAATTATTTGCCTTTTTTGTATTTATTTATTATTTATTTGCCCGTTTGCTAAATATTATACATCGTTCTTTCAGCACAATCAATGGTAGAATTGACCAAGTCAATCAGCTGTTGGAGCTCGATCACCAGAAAAGAGGCGGAGCC[C/T]GATACACGGCTCTGGACAAATGGACCAATCAGCTGAACTCTCTCAATCAGGCCATAGTCAGCAAACTGGCTTGATTTCGACACCGAAGATCCTGGGGGAAAAACAACAACAAACAAACTCACCCATCGGGCAACCGGACAAGCGCAGGCTGTCAGTGACGTTAACTTACTCTCAAGCCCTTTACTCCTGCCATCACACAATCGCATGATGGGGGAGCGTCGTTTGGCTAGTTTGTACTTTTACAGCTGTAGTCCATTTTAAATGTCCTTAACACAAAAAAGCGGAGGTTCCCACTGGATGTCTGCTCTACTGAATTGTTAGGTCTCTAATATGAATATGTTTGCATTACCTGGAAAATAAAAGTTACTTTAATTGCACATATTGGCACTTGGCAGACATTGATAAGGCAAATGTTTGTCTTTATTGAGGACGGGTTTGTGAAAATGAATCATTTTATTTGTTGAACTATCTCTTGTCAGAGTCAGCATGTTTTATTTGGT
Associated Phenotype:
Not determined