Busch Lab

ZMP

fgfr3

Ensembl ID:
ENSDARG00000004782
ZFIN IDs:
ZDB-GENE-000816-1, ZDB-GENE-000816-1
Description:
Fibroblast growth factor receptor 3 [Source:UniProtKB/TrEMBL;Acc:B8JIA2]
Human Orthologue:
FGFR3
Human Description:
fibroblast growth factor receptor 3 [Source:HGNC Symbol;Acc:3690]
Mouse Orthologue:
Fgfr3
Mouse Description:
fibroblast growth factor receptor 3 Gene [Source:MGI Symbol;Acc:MGI:95524]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa13480 Nonsense Available for shipment Available now
sa273 Nonsense F2 line generated Not yet available
sa9259 Nonsense Mutation detected in F1 DNA Not yet available
sa15832 Nonsense Available for shipment Available now
sa1675 Essential Splice Site Available for shipment Available now
sa35442 Nonsense Mutation detected in F1 DNA Not yet available
sa28078 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10458 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13480
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013534 Nonsense 120 804 3 23
ENSDART00000125883 Nonsense 120 802 3 22
Genomic Location (Zv9):
Chromosome 13 (position 13119347)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13127432
GRCz11 13 13258565
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACTGTGCTGCAGACTAAAAGCATCTCTCTCTTTCTTCATTTCTCAGATT[C/A]GCTGTCCTCTGGTGATGATGAGGACTATGATGAAGATGAGGACGAGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa273
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013534 Nonsense 461 804 15 23
ENSDART00000125883 Nonsense 459 802 14 22
ENSDART00000013534 Nonsense 461 804 15 23
ENSDART00000125883 Nonsense 459 802 14 22
Genomic Location (Zv9):
Chromosome 13 (position 13099390)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13097758
GRCz11 13 13230233
KASP Assay ID:
554-2825.1 (used for ordering genotyping assays)
KASP Sequence:
CTAAYGTGTCTGAACTTGAACTGCCCTCTGACCCCAAGTGGGAGTTTACT[C/T]GAACAAAGTGAGTTGAAGCTAAAGCACTCATCAGATGATTTTAATGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9259
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013534 Nonsense 461 804 15 23
ENSDART00000125883 Nonsense 459 802 14 22
ENSDART00000013534 Nonsense 461 804 15 23
ENSDART00000125883 Nonsense 459 802 14 22
Genomic Location (Zv9):
Chromosome 13 (position 13099390)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13097758
GRCz11 13 13230233
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTAAYGTGTCTGAACTTGAACTGCCCTCTGACCCCAAGTGGGAGTTTACT[C/T]GAACAAAGTGAGTTGAARCTAAAGCACTYATCAGATGATTTTAATGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15832
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013534 Nonsense 560 804 18 23
ENSDART00000125883 Nonsense 558 802 17 22
Genomic Location (Zv9):
Chromosome 13 (position 13097699)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13096067
GRCz11 13 13228542
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTACGTGCTGGTAGAATACGCCTCTAAAGGGAATCTTAGGGAATACTTA[C/T]GAGCCAGAAGGCCACCTGGGATGGACTACTCATTCGACACCTGTAAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1675
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013534 Essential Splice Site 645 804 19 23
ENSDART00000125883 Essential Splice Site 643 802 18 22
Genomic Location (Zv9):
Chromosome 13 (position 13097282)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13095650
GRCz11 13 13228125
KASP Assay ID:
554-1621.1 (used for ordering genotyping assays)
KASP Sequence:
CCTTGCCAGAGATGTGCACAACATTGACTACTACAAGAAGACCACCAACG[T/A]AAGTCGACACWGATTATCAATCTCGAAGGAGAGAGCTCTTGGGTGGCATT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28079
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013534 Nonsense 652 804 20 23
ENSDART00000125883 Nonsense 650 802 19 22
Genomic Location (Zv9):
Chromosome 13 (position 13094578)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13092946
GRCz11 13 13225421
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTGTTCTGACTGATCTGTGTCCTTTCAGGGTCGTCTGCCCGTCAAATG[G/A]ATGGCACCAGAAGCACTGTTCGATCGCGTCTACACGCACCAGAGCGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35442
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013534 Nonsense 687 804 21 23
ENSDART00000125883 Nonsense 685 802 20 22
Genomic Location (Zv9):
Chromosome 13 (position 13090690)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13089058
GRCz11 13 13221533
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTATGGTGTGTTGTTGTGGGAGATTTTCACTCTTGGTGGATCCCCGTA[T/A]CCAGGTATCCCAGTGGAGGAGCTCTTTAAACTGCTGAAGGAAGGCCATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28078
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013534 Essential Splice Site 715 804 21 23
ENSDART00000125883 Essential Splice Site 713 802 20 22
Genomic Location (Zv9):
Chromosome 13 (position 13090605)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13088973
GRCz11 13 13221448
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGGAAGGCCATCGGATGGACAAACCGGCCAACTGCACTCATGAACTG[T/C]ACGCTTGTTATTCATCTTTTAAAACGCCTCATGTTTTGAGTCATCTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10458
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013534 Essential Splice Site 750 804 22 23
ENSDART00000125883 Essential Splice Site 748 802 21 22
Genomic Location (Zv9):
Chromosome 13 (position 13088122)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13086490
GRCz11 13 13218965
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACAGCTGGTGGAGGACCACGACAGGGTTCTTTCCATGACCTCCACTGAC[G/T]TAAGAGCTCTGGTGCATCAAACCAAAMACCTTAAACCTTTCACACTCAAC
Associated Phenotype:
Not determined