Busch Lab

ZMP

wdr36

Ensembl ID:
ENSDARG00000004774
ZFIN ID:
ZDB-GENE-030131-464
Description:
WD repeat-containing protein 36 [Source:RefSeq peptide;Acc:NP_955860]
Human Orthologue:
WDR36
Human Description:
WD repeat domain 36 [Source:HGNC Symbol;Acc:30696]
Mouse Orthologue:
Wdr36
Mouse Description:
WD repeat domain 36 Gene [Source:MGI Symbol;Acc:MGI:1917819]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa33722 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14176 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26585
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014049 Nonsense 41 896 1 23
Genomic Location (Zv9):
Chromosome 5 (position 57323206)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55243805
GRCz11 5 55914022
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCATCTGGCGCACGTGGTTCGCTTCCATAAGAAACACAGAGAGTTCTA[T/G]GTGGTCACTGCAGTCGGACAATGTTTCCATACATATAACGTAAGTGAATA
Long Flanking Sequence:
CCTCTGCGTCAAACAGAAAGTAGGGGAAAAATTAAACAGTGGGAAAATAATTCAGGAGGCTAATAATTCTGACTTCAACTGTATATTGATACATATATTGTTTAAATTTCAAGTGTTTGTTTTATTTTATTTAAACAAAACTTTCTGATTGACTTAAATTTAAATAATTAAGAATCATTACTTAGTGAAGTGATTACTTTTTTTAAGTAACTTACTGGTAGGAACCGAAGGAAATTGTTTCCACACGACCCGTGTTTAGCGTAGCACTGTTTTGCTACTGTTCTCTGCTGGTACAGAAATGTGCCTGAAAGTGCAATAAACGTTAACCGGGATTTTGAGCACAGACAGCGAAGATTAAGATTGTGCTGGCGAATATACATGAGCAGCATGTCTGCGAACAAAAAAGGGAGCGTGATCTTCTCTGGATTCAGGGCGCTGGGGCTTTACTCTAATCATCTGGCGCACGTGGTTCGCTTCCATAAGAAACACAGAGAGTTCTA[T/G]GTGGTCACTGCAGTCGGACAATGTTTCCATACATATAACGTAAGTGAATACCTGTTTCATGCTTGGTTTGACATGATTTCGGACGGGTTTATGGTTGTTAGTTACCATAGTAATTAAGTATTTTAAGCACACATTTTTGTTATTTTAGGAAATTAAGCATTTAAAGTGCGCAACTTGGTGTCTCTACTTGTTTATAACAAAGTTTATACCAAAGTTTGACTTTCGTACTGCAAAAAAAAAATATTTTAGAGTCATATCTGTTATGGTCAAGATATCGTTTCTGTAAATGTCCAAAATACAGTGGTAGCATGTGATGTCATATCAAGCCATTACGTCTTAAACCTGTAACGTTAACGTTACTAATGGCAGTTCTGTGGTCATATTGGAAGTACCCTGGATCATAGATATATACATACGTATATATCTATGACCCTGGATTATAGTTACCAACCATGTTGAATATAGGTTATTTGTCGTTACTTCTTTTCTGTCCTTGCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33722
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014049 Essential Splice Site 97 896 3 23
Genomic Location (Zv9):
Chromosome 5 (position 57308999)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55229598
GRCz11 5 55899815
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTATGCAGCATATGGAAAACTTATCTCCGCTTTTGCTAGAAGCAGAGAG[G/A]TAAAGTATACATAGACACGCAGTGCATTGCATAACACTGGAGTGAATTGA
Long Flanking Sequence:
ATGAATTAAAAAAATGTCTTTATTTCTAGATGTAAAATATATTTTTAAATGCATTGTTCTATTGCTTTATTAAATAACATTTAAAATCACAATTTAAATAAACACAATTAAATGTCTTATTTATTTATCCATTAATTGTACGTTTTAATTGTGATTTGTTTATGCACATTTTAATGCTTCAATTCTTAAATTGACAATTTGAATCTTTATTTTAGTTCTAATTCGCACTCCAGCTCCTCCATTCATAATGTCATTTCCTTTCAGGTAAAGAAACTAGGAATCGTTGCAGTCAGTAAGTAGGATTCAGTACATTTATTTAACAGTAATCTAACCATAGTGTATTTTCCAACATGATCAAACCATTGTGAAGTTAAACATTTTTACTATCCCCCTGTTCAGGTAATGCCCTCCCAGAAGACATTTCATCCGTGACAGCAGATTGTATGCTTGTCTATGCAGCATATGGAAAACTTATCTCCGCTTTTGCTAGAAGCAGAGAG[G/A]TAAAGTATACATAGACACGCAGTGCATTGCATAACACTGGAGTGAATTGAAAATAAGAATAAGCCAGAAGTAATGGTCATTTTTTTCTGCTGTTGTTTTCATCTAGGTTGTTCACACATACACCGGTCACCAAGCTGATGTGCATTTGCTGCTGCCTTTTGGAAATCATTTGATTTCTGTTGATAAGGATAATGTGGTTATCATTTGGGATGTGGAGTCTGAGGGTTTGTTTTTGTATTTATTTATTTAAATTGATTACTTTAATTGATTTGTTTTTACAATGCATGTATTATGTTTTGTCATCCTTACAGACACATATCTGCAGATTTCATATGACAAAGCATCTTTTGAGGTCTCCGCTTTGATGCATCCGAGCACCTACCTGAACAAAATCCTGTTTGGAAGCAGTCAAGGGAGTCTTCAGTTATGGAACATCAAATCAAAGTATGCACTTCTAAGCTAGTGAACGCTGAATGTAGATTGTCATATATAGGATTCCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26584
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014049 Nonsense 139 896 5 23
Genomic Location (Zv9):
Chromosome 5 (position 57308680)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55229279
GRCz11 5 55899496
KASP Assay ID:
2259-6571.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGTTTTTACAATGCATGTATTATGTTTTGTCATCCTTACAGACACATA[T/A]CTGCAGATTTCATATGACAAAGCATCTTTTGAGGTCTCCGCTTTGATGCA
Long Flanking Sequence:
ACAGTAATCTAACCATAGTGTATTTTCCAACATGATCAAACCATTGTGAAGTTAAACATTTTTACTATCCCCCTGTTCAGGTAATGCCCTCCCAGAAGACATTTCATCCGTGACAGCAGATTGTATGCTTGTCTATGCAGCATATGGAAAACTTATCTCCGCTTTTGCTAGAAGCAGAGAGGTAAAGTATACATAGACACGCAGTGCATTGCATAACACTGGAGTGAATTGAAAATAAGAATAAGCCAGAAGTAATGGTCATTTTTTTCTGCTGTTGTTTTCATCTAGGTTGTTCACACATACACCGGTCACCAAGCTGATGTGCATTTGCTGCTGCCTTTTGGAAATCATTTGATTTCTGTTGATAAGGATAATGTGGTTATCATTTGGGATGTGGAGTCTGAGGGTTTGTTTTTGTATTTATTTATTTAAATTGATTACTTTAATTGATTTGTTTTTACAATGCATGTATTATGTTTTGTCATCCTTACAGACACATA[T/A]CTGCAGATTTCATATGACAAAGCATCTTTTGAGGTCTCCGCTTTGATGCATCCGAGCACCTACCTGAACAAAATCCTGTTTGGAAGCAGTCAAGGGAGTCTTCAGTTATGGAACATCAAATCAAAGTATGCACTTCTAAGCTAGTGAACGCTGAATGTAGATTGTCATATATAGGATTCCGTGACCCTTAAAGTTTGTTTTATGATTTAATGATATGAAGCTGGTTTATTAAATTAAATTGCGTTGCTTAAAATATTATACATTTTGGATAGCTGAGTATCTTGTAGAACTTTTTTTTTATTTTTAGCATTTTGTGCAGTTTTGTACGTTTTGAACCTTAAAGTTTAAACTGCAAGCGGTAAAATCGTAATTATTTTATAAATATTTAAAAAATAAAATGATTAAATGGATTTAATTACCTATTTTCTAAAAAAAATTAATTTCTTTTGTCTTTGCCTTAATGCCAGTACATACTATTGCTATAGTTATTTTGCAAGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14176
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014049 Nonsense 637 896 17 23
Genomic Location (Zv9):
Chromosome 5 (position 57288983)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55209582
GRCz11 5 55879799
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
YGGGAACTTCCTGGCCTCGTCGCACGTTGACGGCCTCGGTGTTTACTTAT[G/A]GTAAGAGATTGCWAWGCAGATACGTTCTTTGTGAACTCTTGTTTTCAATT
Long Flanking Sequence:
CAGGTAATACTAAGATAAGTGTTAGTGAGATTGCATCATTGTAGTTTTACACCAAATCACCCAAAATAGCCTTTTGCAGGAGGGAAAGACCAGACCTGTCCAGTGACACCTTTTCCACTTTCTATATTATTTACTGGTTAGATATTTATGATGACCTTTTTTCGGTTAGTCAGCCTTTGATACTTTTCAAAGTAACCAGTAAAGCCAAATTCAGAGATAATTATTATCTTGCGAAGATGTGGCCATAGTGACATTTAGTGTGTCGGATATTTTTTTGATTGTTCTAGCGGGGATTCCTCCAGCCCATGAAGTCCCCTCTGGCCAAATCTAATGATTGAATGATTTCCTCAAACACTTTCACATCCTTTAACTTTCTCTTGCTTTTTTTCATAGTTTGGTCGACTGTTTCCTGGTAGAAGCAGCAGCCGTGAGTGTCAGTTTGTCCCCTACCGGGAACTTCCTGGCCTCGTCGCACGTTGACGGCCTCGGTGTTTACTTAT[G/A]GTAAGAGATTGCAATGCAGATACGTTCTTTGTGAACTCTTGTTTTCAATTGATTTTTTCACACACATGAGATAAGAGTGTTAAACTTGGGGGTAAGCTTTTAGCACAGTTATCTCGTTGTTAATCTACAATGAACAGTGAAAAGCAATTGTGGGTTATGAGTTCATGAGACTGCAGAATGAATGCTGAGGAATTTTTGACTAACTGCTAATTTATTATTATTTTAATTATTAATATTGTTATATTTAAACAGATCCACAGTGTATATGGGAAGTATTCATAGCGCTTCACCTTTTCCACAGTTTTTTGTTACAGCCTTATTCCAAAATGTATTAAATTCATTTATTTGCTCAATTCTACACACAGTACCTCATAATGACAATGTGAAAAGGGATTTTTCAAATTGTTGAAAATTTATAACAAATAAAATACCTGAAAAATCACATAGAACATCAGTATTCACAGCTCTAAATTGAGCTCAAGTACATTTTGTTTCCAATG
Associated Phenotype:
Not determined