Busch Lab

ZMP

zgc:100868

Ensembl ID:
ENSDARG00000004748
ZFIN ID:
ZDB-GENE-040801-33
Description:
hypothetical protein LOC554458 [Source:RefSeq peptide;Acc:NP_001003526]
Human Orthologues:
PRSS21, PRSS38, PRSS42, PRSS44, PRSS45, PRSS50
Human Descriptions:
protease, serine, 21 (testisin) [Source:HGNC Symbol;Acc:9485]
protease, serine, 38 [Source:HGNC Symbol;Acc:29625]
protease, serine, 42 [Source:HGNC Symbol;Acc:30716]
protease, serine, 44 [Source:HGNC Symbol;Acc:37324]
protease, serine, 45 [Source:HGNC Symbol;Acc:30717]
protease, serine, 50 [Source:HGNC Symbol;Acc:17910]
Mouse Orthologues:
Prss21, Prss38, Prss41, Prss42, Prss43, Prss44, Prss45, Prss46, Prss50
Mouse Descriptions:
protease, serine, 21 Gene [Source:MGI Symbol;Acc:MGI:1916698]
protease, serine, 38 Gene [Source:MGI Symbol;Acc:MGI:2685095]
protease, serine, 41 Gene [Source:MGI Symbol;Acc:MGI:1918253]
protease, serine, 42 Gene [Source:MGI Symbol;Acc:MGI:2665280]
protease, serine, 43 Gene [Source:MGI Symbol;Acc:MGI:2684822]
protease, serine, 44 Gene [Source:MGI Symbol;Acc:MGI:1920586]
protease, serine, 45 Gene [Source:MGI Symbol;Acc:MGI:3605764]
protease, serine, 46 Gene [Source:MGI Symbol;Acc:MGI:1921556]
protease, serine, 50 Gene [Source:MGI Symbol;Acc:MGI:2447303]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa5731 Essential Splice Site F2 line generated Not yet available
sa33262 Nonsense Mutation detected in F1 DNA Not yet available
sa13737 Nonsense Available for shipment Available now
sa33261 Essential Splice Site, Missense Mutation detected in F1 DNA Not yet available
sa40129 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26128
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013553 None None 551 3 11
ENSDART00000135192 Nonsense 70 498 3 10
Genomic Location (Zv9):
Chromosome 3 (position 39481619)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39344979
GRCz11 3 39486837
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTTCAAAGAGACGGCAGCCATTTCTGTGGTGGATCTCTCATTAACAAC[C/T]AATGGATTCTGACTGCAGCCCATTGCTTTCCCAAGTATAAAGACAGGCAA
Long Flanking Sequence:
TACCACTTACTATAATTTCATCAATAATAATTTTCTAGACAAGCAAAACATATGGTCTTGTTTTAAGTAATAGGACAATATTAAGTTTTTCCTTAAAACAAGATTATTTTGCTTATCCCACTGGCAGATTATTTTTGCTTGTTTTAATATATTAATATATATATATATATATATATATATTAAATCTAACATTGGGTTACGACAGCCCAGCACTTTTTAAAATCATTTTGCTGAATTTATTAGTAACTCAGTCTGTATGTTGTTTTCTAGGGTGTGACGCACAACTAGATGGTAACCAGTTTTTCAACACATCACTTAAAATAGCCAGATTGTAGTGTTTCTGTGGCTAAAATGTGCATTTTTTATTGTCAGTGTGTGGTACGGCACCTCTCAACTCAAGGATAGTGGGAGGACAGAATGCACCGGTTGGCGCTTGGCCATGGCAGGTCAGTCTTCAAAGAGACGGCAGCCATTTCTGTGGTGGATCTCTCATTAACAAC[C/T]AATGGATTCTGACTGCAGCCCATTGCTTTCCCAAGTATAAAGACAGGCAACAAGTCCTTTCAAAATACTGTATGTCATTTACCTGATGTGGTTAACAGTTGTTGTCATTTTCCAGCCCTTCGACGACTGGTCTACTTGTATATTTGGGCCTACAAAAACTAGCATCATTTGAATCATACTCGATGTCCAGTGCTGTCTCCAATATCATAAAACATCCAAACTACAATAGTGATACTGAAGACAATGACATCACTCTTCTGCAACTGGCCTCAACAGTGAGCTTTTCGAACTACATCAGACCTATCTGTCTGGCTGCATCCGACAGTACTTTCTTCAATGGAACTTTGGTCTGGATCACTGGATGGGGGAACACTGCCACAGGCGGTAAGCATTTACTTTTACTCTTTTCAATCAGAGTTAGAACATACAGTGTACTCCTGCAGTAGATGACACGGGCTGTTTCTTTTTTCTCTCAGTCAGCCTACCTTCCCCGGGGACTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2139
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013553 Essential Splice Site None 551 3 11
ENSDART00000135192 Essential Splice Site 81 498 3 10
ENSDART00000013553 Essential Splice Site None 551 None 11
ENSDART00000135192 Essential Splice Site 81 498 None 10
Genomic Location (Zv9):
Chromosome 3 (position 39481583)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39344943
GRCz11 3 39486801
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTCATTAACAACCAATGGATTCTGACTGCAGCCCATTGCTTTCCCAAG[T/G]ATAAAGWCAGGCAACAAGTCCTTTCAAAATACTGTATGTCATTTACCTGA
Long Flanking Sequence:
AGACAAGCAAAACATATGGTCTTGTTTTAAGTAATAGGACAATATTAAGTTTTTCCTTAAAACAAGATTATTTTGCTTATCCCACTGGCAGATTATTTTTGCTTGTTTTAATATATTAATATATATATATATATATATATATATTAAATCTAACATTGGGTTACGACAGCCCAGCACTTTTTAAAATCATTTTGCTGAATTTATTAGTAACTCAGTCTGTATGTTGTTTTCTAGGGTGTGACGCACAACTAGATGGTAACCAGTTTTTCAACACATCACTTAAAATAGCCAGATTGTAGTGTTTCTGTGGCTAAAATGTGCATTTTTTATTGTCAGTGTGTGGTACGGCACCTCTCAACTCAAGGATAGTGGGAGGACAGAATGCACCGGTTGGCGCTTGGCCATGGCAGGTCAGTCTTCAAAGAGACGGCAGCCATTTCTGTGGTGGATCTCTCATTAACAACCAATGGATTCTGACTGCAGCCCATTGCTTTCCCAAG[T/G]ATAAAGACAGGCAACAAGTCCTTTCAAAATACTGTATGTCATTTACCTGATGTGGTTAACAGTTGTTGTCATTTTCCAGCCCTTCGACGACTGGTCTACTTGTATATTTGGGCCTACAAAAACTAGCATCATTTGAATCATACTCGATGTCCAGTGCTGTCTCCAATATCATAAAACATCCAAACTACAATAGTGATACTGAAGACAATGACATCACTCTTCTGCAACTGGCCTCAACAGTGAGCTTTTCGAACTACATCAGACCTATCTGTCTGGCTGCATCCGACAGTACTTTCTTCAATGGAACTTTGGTCTGGATCACTGGATGGGGGAACACTGCCACAGGCGGTAAGCATTTACTTTTACTCTTTTCAATCAGAGTTAGAACATACAGTGTACTCCTGCAGTAGATGACACGGGCTGTTTCTTTTTTCTCTCAGTCAGCCTACCTTCCCCGGGGACTCTACAAGAAGTGCAAGTGCCGATTGTTGGAAACAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5731
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013553 Essential Splice Site None 551 3 11
ENSDART00000135192 Essential Splice Site 81 498 3 10
ENSDART00000013553 Essential Splice Site None 551 None 11
ENSDART00000135192 Essential Splice Site 81 498 None 10
Genomic Location (Zv9):
Chromosome 3 (position 39481583)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39344943
GRCz11 3 39486801
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTCATTAACAACCAATGGATTCTGACTGCAGCCCATTGCTTTCCCAAG[T/G]ATAAAGWCAGGCAACAAGTCCTTTCAAAATACTGTATGTCATTTACCTGA
Long Flanking Sequence:
AGACAAGCAAAACATATGGTCTTGTTTTAAGTAATAGGACAATATTAAGTTTTTCCTTAAAACAAGATTATTTTGCTTATCCCACTGGCAGATTATTTTTGCTTGTTTTAATATATTAATATATATATATATATATATATATATTAAATCTAACATTGGGTTACGACAGCCCAGCACTTTTTAAAATCATTTTGCTGAATTTATTAGTAACTCAGTCTGTATGTTGTTTTCTAGGGTGTGACGCACAACTAGATGGTAACCAGTTTTTCAACACATCACTTAAAATAGCCAGATTGTAGTGTTTCTGTGGCTAAAATGTGCATTTTTTATTGTCAGTGTGTGGTACGGCACCTCTCAACTCAAGGATAGTGGGAGGACAGAATGCACCGGTTGGCGCTTGGCCATGGCAGGTCAGTCTTCAAAGAGACGGCAGCCATTTCTGTGGTGGATCTCTCATTAACAACCAATGGATTCTGACTGCAGCCCATTGCTTTCCCAAG[T/G]ATAAAGACAGGCAACAAGTCCTTTCAAAATACTGTATGTCATTTACCTGATGTGGTTAACAGTTGTTGTCATTTTCCAGCCCTTCGACGACTGGTCTACTTGTATATTTGGGCCTACAAAAACTAGCATCATTTGAATCATACTCGATGTCCAGTGCTGTCTCCAATATCATAAAACATCCAAACTACAATAGTGATACTGAAGACAATGACATCACTCTTCTGCAACTGGCCTCAACAGTGAGCTTTTCGAACTACATCAGACCTATCTGTCTGGCTGCATCCGACAGTACTTTCTTCAATGGAACTTTGGTCTGGATCACTGGATGGGGGAACACTGCCACAGGCGGTAAGCATTTACTTTTACTCTTTTCAATCAGAGTTAGAACATACAGTGTACTCCTGCAGTAGATGACACGGGCTGTTTCTTTTTTCTCTCAGTCAGCCTACCTTCCCCGGGGACTCTACAAGAAGTGCAAGTGCCGATTGTTGGAAACAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33262
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013553 Nonsense 152 551 6 11
ENSDART00000135192 Nonsense 255 498 6 10
Genomic Location (Zv9):
Chromosome 3 (position 39478522)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39341882
GRCz11 3 39483740
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGTGAGTTTTGGTACAGGCTGTGCTCAACCAAACTTCCCTGGTGTGTA[T/A]ACCAGGGTGTCTAAATATCAGAGCTGGATCCAGCAGAGAATCACCACCAC
Long Flanking Sequence:
AACTGATATCAGGACAACTATTCCAGAGTTTAGGGGCCAGATATTAAAATGCTCAACCTCCTACAACTTTATTGTGTAATAATCACTTTATAGAAACTACACAGAACCCTCATGAAAGTTCTTAAGATAGACATACTGTACATATGATGAATGTTCATCCAGCTTCCAGCCATACTGGTTTTACATTCGATGACAAGTTTTAGAAAGAAAAAGTACCGCTGAATGCTTCAGGCCATTTCCCTGACAGAACACAGCTGACACTGTAAACTTGCATTGACAAGAATATATTCACACTATTCCTTCATATTATATTTTACAGCTGCAACCTTCAGCTGGAGTAGATCTGCAGAATGGTTTTTACACCTAGTCACTAACTCCCTCTTCATTCGACAGGGTGACTCTGGTGGTCCAATGGTCAGCAAACAGGGCTCAGTTTGGATCCAGTCTGGAATTGTGAGTTTTGGTACAGGCTGTGCTCAACCAAACTTCCCTGGTGTGTA[T/A]ACCAGGGTGTCTAAATATCAGAGCTGGATCCAGCAGAGAATCACCACCACCCAGCCAGGCTTTGTCATGTACAATTCCAATGGTACTGATGGTGACCTGAGTGTAAACTGCCCTGGTCTCCCCACCATTCCCCCCACCACAGCTTCTACAACACAAACAACTACAATGTCAACTACGACTGTCGCACGTAAGTTTTTTTTAAGTAATCCAAATAAACATTCAGAGACTTTTACTGTATATTACTGGTGAGATCAATTCTGCTTTTGGTATCACTTTAGTGATGGTCCATTTGACGCATTTTGTTGAATTTAAGTTACATTGCATCTACATGCCAACTAATTCTCATTAGATTACATGTAGATTGTTAGGTTGGGGTTAGGGTTAGAGTACTTGCAAAGTTTCTTACCGCCAATGATGTCTGTTGAAGCAGCATTATCAGCAGACATTAGCTGACAATCCTCAAATAAGAACATGTTTTAGTCAACAAAATGTGCAACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13737
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013553 Nonsense 389 551 9 11
ENSDART00000135192 Nonsense 492 498 9 10
Genomic Location (Zv9):
Chromosome 3 (position 39474718)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39338078
GRCz11 3 39479936
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGGAAACTCATCCTCAAACAACAGTATTTGTACAACTGCTTTCGACTTA[C/T]AACAGGCAAGTTGTTTCTGSTTTTGTTTTGACTTTTTNGGTGAATAAAAT
Long Flanking Sequence:
TGATGATAAGTTAAAAGATTTGATTGAGTAGAGATCTTTTGTTGTTGGTTTTCAGCTCCACCAATGCCACAGGATGGACTGTTGTCCTGGGCCGACTCAATCAGAACAGCTCCAACCCCAATGAGGTCTCCATCAAAGTGGCAAATTTCTCAATGAGCAACAATTCGGGTAACAACGTTGCCGTCCTGCAGTTGGCGGTTACACCAAACTTCACCAATTACATTCAGCCCATATGTGTGGACTTGGGAGGCAACAATGTTGACGCCAACACTCAATGCTGGGCAGCAGGATGGGGATCAGGAGCAGGAGGAGGTGAGCTCAATATCTGTGGCCATGCTATGCTAATCACGAAACCTCATTTACTTAGATTTTTAAACAAATCTTCTCCATTTGAATGTGTTTTTATAGTGAATCAAACTCTTCAGCAATACCAGACTTCTATTGTGAGCTGTGGAAACTCATCCTCAAACAACAGTATTTGTACAACTGCTTTCGACTTA[C/T]AACAGGCAAGTTGTTTCTGGTTTTGTTTTGACTTTTTTGGTGAATAAAATTACTTAAGGAGAGGGCTATAACCATGGTGGACATTGAACAGAACAAGTATCAAATTACTAAACTGTAAAAGTGACAGTGACCGTGAGTCCAGCTCAGTTAATGTAGAAGGTTTGAATGGAGAAAGAGGGAAGGGTTCGCATGAAAACGGGAGTATCATTACGTGCACTACAGCTGTTTTTTACACCGCAACACAGATGGTGATTCGCAGAGCAGCATTTACAGTGGATCTAAGAGCTGTGTGGACGATTTTCAGTCCATATTATTGTAGTGATATAATTTAGTAACTAAATCATTTTGACTAAGGTATGTCTTTAACTGAAAGAGTACTGCTGACGATAACTAACCATCTGAATAAACATAAACAAAGAACACTGATCACACACTTACCAAATTAGAGACAGGAAAATCAACACCAGCTGGAACCACATCTTTATTTTAAAGAAGATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33261
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013553 Missense 392 551 10 11
ENSDART00000135192 Essential Splice Site 494 498 10 10
Genomic Location (Zv9):
Chromosome 3 (position 39470209)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39333569
GRCz11 3 39475427
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATGAAGGTAATAATCCTCTTCACTGTGTGTCTTTCACTCTCTTAGGGT[G/T]TTCAAGGTGGTCCACTGATGTGTTTGGTGGGTCAGTCATGGATCCATATT
Long Flanking Sequence:
TCTGAGTTTTGGAAATCACCCCCACTTTGGTAAACACTGGACTAGATTGCTGGTGATTGTGACATTAAAATCCACTTAAATTTGTAGTTAACTTAATTCCCAGCAAGCATTTTTGCATTTAATAGACGCTTAATTGACATCTAAACGTAGACAGCTTGGCTAAAACAAGGCCCGTCAGTGAAAATCTAATAGACATCTAAGAACAGCTCAAAACTAGACTAGTCGTCAAATAGACAGATTAGACAGACTTGATATATGTAGTCATTCATTTCTTTTTATTTGATGACTAATATAGTTTTGGCCTATTTTTAGATCGATTAGATTTTCACTGACAGCCCAAATTTAGACTTGTTTTAGCCAGTAGACATCTATTAGACATCTTTTAAAAAAAATAAAAAACGCTTGCTGGGTTTCTTCATGTATTGCCAACACAAATCGATTTTTTACAGTGTATGAAGGTAATAATCCTCTTCACTGTGTGTCTTTCACTCTCTTAGGGT[G/T]TTCAAGGTGGTCCACTGATGTGTTTGGTGGGTCAGTCATGGATCCATATTGCAGTATTAACCATATCGAACAGCAACTCAAACAGCAGCATCTCTAACAGTACTCTGAACAACAGTACTCTCAATAACTGCACCGTCAACAACAGCACCGTCAACAACTGCACTGTCAATAACAGCACTGTCAATAACAGCACAAGCAGCACAGGCAGCAAAGGTGCTGACTTGTACTTCCCTGTTAAGGCTCAGGGTGTCCAGATCTTCACTAAAACCTCCAGCTTTTCCACATTCCTGACAGCTGTGATCAGTTCCTTCCCTCAAAAAGCTACAAACACTACAAGTGCAAGTACAAGCGCTCCTTCTGCAAGCACCTCAAATACAACCCAGTCTAATGGCTCACCAGCATCTTTTTCCTCCTGCTATACAGTTTCTGTTTTATTCTCCTCACTTCTAACTCTCCAAATCTTTCACAAGAGCATCTTTTGAGGAAAAACGGCTCACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40129
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013553 Essential Splice Site None 551 None 11
ENSDART00000135192 None None 498 10 10
Genomic Location (Zv9):
Chromosome 3 (position 39469449)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39332809
GRCz11 3 39474667
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTACACAAGTTTTTTTTTTTTTTTTAAACAGATTTAACAGTTTATCTTG[T/A]GTTTCACAAATTTTGGTAACACTTTATTTTGATGGTCCATTTGAGTATTA
Long Flanking Sequence:
CACTAAAACCTCCAGCTTTTCCACATTCCTGACAGCTGTGATCAGTTCCTTCCCTCAAAAAGCTACAAACACTACAAGTGCAAGTACAAGCGCTCCTTCTGCAAGCACCTCAAATACAACCCAGTCTAATGGCTCACCAGCATCTTTTTCCTCCTGCTATACAGTTTCTGTTTTATTCTCCTCACTTCTAACTCTCCAAATCTTTCACAAGAGCATCTTTTGAGGAAAAACGGCTCACTGTTAGAGTGAATGTGAAATATCCAGACCCATATTAATATGTTTTTCAGTATGCCCCATGACTGATTAGATTGTCATACATTTAGCATTCAAGGCTTTTGTGGAGCATATTCAGTACTAGACAAATGTGAATGTTAATTGATAAGTCAGACCATGAAGATGTTGAGTGTTTGTATACTGTGCAATTACACAAAAAAAATCTGTTAAATAACAGTTACACAAGTTTTTTTTTTTTTTTTAAACAGATTTAACAGTTTATCTTG[T/A]GTTTCACAAATTTTGGTAACACTTTATTTTGATGGTCCATTTGAGTATTAGTAGGCTATCTGCGTAATATCTGCTGATACTGCTCCCTCAACAGACATTTAACTGACTGTAAGAAACTTGCAAGTACGAGTCAAACCTACAATAACCACAACCTAACAGTCTACTTATAATCTAATGAGAATTAATTGCAATGTAACTTAAATTCTACAAACGGACCCTCAAAATAAAGTGTGACCCAAGTGTTTTCCATTTATTTCCGGCTCTAAGTTGCATTATGGGATGTTTATCACTGCTTTTGAAATTGACAATTCAACTTAGCGGTTTAACAAAGTGACTTTTATTGACATTTTAGTCGTTTGAAATGTATAAGAAATAATATAAAAAAATAATTAATAAATAATTATTTTATAACATAATAGAAAACATGTCACTTTAAACTATTAAATATATTAATCAAAGTAATGTATTTTAACTTTTCAAGTTGTTGAAAGAATGAAGCA
Associated Phenotype:
Not determined