Busch Lab

ZMP

hnrnpu

Ensembl ID:
ENSDARG00000004735
ZFIN ID:
ZDB-GENE-030131-6422
Description:
heterogeneous nuclear ribonucleoprotein U isoform 2 [Source:RefSeq peptide;Acc:NP_001028767]
Human Orthologue:
HNRNPU
Human Description:
heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) [Source:HGNC Symbol;Acc:504
Mouse Orthologue:
Hnrnpu
Mouse Description:
heterogeneous nuclear ribonucleoprotein U Gene [Source:MGI Symbol;Acc:MGI:1858195]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa23760 Nonsense Available for shipment Available now
sa43492 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17952 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23760
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122696 Nonsense 28 796 1 13

The following transcripts of ENSDARG00000004735 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 35083472)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35155985
GRCz11 20 35058864
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACGAGCTGAAGGACGAGCTAAAGAAGCGGCAGCTCTCTGACAAGGGGT[T/A]GAAGGCCGAGCTCATGGAGCGTCTGCAGGCCGCGCTCGACGCAGAGGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43492
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122696 Essential Splice Site 209 796 3 13

The following transcripts of ENSDARG00000004735 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 35087407)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35159920
GRCz11 20 35062799
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGGAAGTGGATGAAGAGTTTGATGACACCCTGGTCTGCTTGGATCCAT[G/A]TGGGTGTTTTTTTTTTTTTTATATGTGAAATGTTCTGACCAGGAGTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17952
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122696 Nonsense 613 796 10 13

The following transcripts of ENSDARG00000004735 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 35090116)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35162629
GRCz11 20 35065508
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGAGAAGAAGCCCAACCAGGGACCCCCAACTCCCAAACGGGGATCCCGC[C/T]GAGGMAGAGGGCAAAAGAACCAGTTCAACAGGANNNNNNNNNGTGGTGGT
Associated Phenotype:
Not determined