Busch Lab

ZMP

foigr

Ensembl ID:
ENSDARG00000004726
ZFIN ID:
ZDB-GENE-030131-1723
Description:
UPF0636 protein C4orf41 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q1RLX4]
Human Orthologue:
C4orf41
Human Description:
chromosome 4 open reading frame 41 [Source:HGNC Symbol;Acc:25751]
Mouse Orthologue:
D030016E14Rik
Mouse Description:
RIKEN cDNA D030016E14 gene Gene [Source:MGI Symbol;Acc:MGI:2444585]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22424 Nonsense Available for shipment Available now
sa30977 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3887
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054809 Essential Splice Site 149 1132 4 30
Genomic Location (Zv9):
Chromosome 14 (position 7335126)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 7060605
GRCz11 14 7367014
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAAAGGTYGCTGTTGTTCTGATTCAGAAGAAAACCCCTCTCCCACCAGG[T/A]AACGCAAAACTGAAATGCTTGCTTTTAGTACTTCAGTCTAGATGTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22424
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054809 Nonsense 693 1132 20 30
Genomic Location (Zv9):
Chromosome 14 (position 7305894)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 7031373
GRCz11 14 7337782
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTGTCTGGTTTTGTCTTTCAGATCACCAGTGTGGGACTAATGTTAGGT[C/T]GAGAAACGGGCCGTTATGTTTATCTGAATTGGCGGGGCGGTTGGGGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30977
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054809 Essential Splice Site 898 1132 24 30
Genomic Location (Zv9):
Chromosome 14 (position 7303714)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 7029193
GRCz11 14 7335602
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGAAACGGTTGTTCCCTTTGAAGTGGCTATGAAGTTTGTGTCCAGTAAG[G/A]TAAGAGGTTTCACTTGGGAGATTTCGGTAATGAAAATCCGTAGTCGTTTA
Associated Phenotype:
Not determined