Busch Lab

ZMP

ptk2.1

Ensembl ID:
ENSDARG00000004672
ZFIN ID:
ZDB-GENE-020114-1
Description:
focal adhesion kinase 1 [Source:RefSeq peptide;Acc:NP_571871]
Human Orthologue:
PTK2
Human Description:
PTK2 protein tyrosine kinase 2 [Source:HGNC Symbol;Acc:9611]
Mouse Orthologue:
Ptk2
Mouse Description:
PTK2 protein tyrosine kinase 2 Gene [Source:MGI Symbol;Acc:MGI:95481]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa22876 Nonsense Available for shipment Available now
sa22875 Nonsense Available for shipment Available now
sa36174 Nonsense Mutation detected in F1 DNA Not yet available
sa36173 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22874 Essential Splice Site Available for shipment Available now
sa13179 Essential Splice Site Available for shipment Available now
sa22873 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22876
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042716 Nonsense 69 1050 4 32
ENSDART00000122474 Nonsense 107 1088 3 31
ENSDART00000128158 None None 280 4 14
ENSDART00000130249 None None 280 4 14

The following transcripts of ENSDARG00000004672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 33126041)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30864556
GRCz11 16 30822483
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATACTGTACATGTTGTCACTCGTATATTTGTGTTTTCAGGGCATTATA[C/T]AGAAGATTTTAGACATCCATAAGGTGAGGTGCGTGTCCTGCTTCGGTCTG
Long Flanking Sequence:
CCACAAGAGCACACACCAATTTCATTAAAGTAATATATTGCTGCTGACATCTCAAATAAAAACTGTCACAGTTCATGCCGGAGATTTTAGCCTGATAAAGCTATTTGATTAATCTCTAAAATTATATTTGTTTTTTAATACTAGGAGTCAAAGATATCTGTAAGGAAATAGAAAAAATAACGTCCATAATGTGTAATTCATCAAAACTCATCATGTGACTCACAGTTCATCAGTTCTTCCCTCCTGGCTCATGCATTTTGCAATTTGCATAATAAATTAAATAACAGTTTTTCTGTCTTGTTAGACATCATATATTATGCTTCGGGAGACTCCATTTCCCTCTCTTACATTTATTTGAACTTACTGACCCATTACAGTACACATTTAACACAGAAGGATTCAAATGAAACTCATCTGGCTTCGAATTTACTGTGCTCTTACTTTATAGAGTCATACTGTACATGTTGTCACTCGTATATTTGTGTTTTCAGGGCATTATA[C/T]AGAAGATTTTAGACATCCATAAGGTGAGGTGCGTGTCCTGCTTCGGTCTGCGCTTGAGTCATCTGAGAACAGGAGAAATTCATTGGCTTCATCCAGACATGGGCGTTTCTCATGTGAGGGAGAGGTACGAGCACAGCCATCCACAGGACGACTGGAGGTGAGTCACTGTTTTAATGTGCCGATTACAGAAGCATAAAAGCATTGTTGAAGCTCAGGGAACATGCCCTTTGACCTGTTTCCCTTTTTAGTTGGTGCTATGTTGAGAGCATGTGATCTGTTGCTGTTTTACTCTGATAATAGTTCAGGGCAGGTCTGGTTTTTTTTATTTTATGAACGCTCACCTCTGCAATTGGATAATAAAATAGATAAAGAAAGTAATCTCCTAATTATCACCATTCTCTTACAGTTCTAAAAGTTAGAATTGGGATTTGCGAGATAGAAATGTACCATTATAAAATGCGTAAAATTCAATTTTTGCAATTATTTGCACCCATGGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22875
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042716 Nonsense 112 1050 4 32
ENSDART00000122474 Nonsense 150 1088 3 31
ENSDART00000128158 Nonsense 11 280 4 14
ENSDART00000130249 Nonsense 11 280 4 14

The following transcripts of ENSDARG00000004672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 33125912)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30864427
GRCz11 16 30822354
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCATTGGCTTCATCCAGACATGGGCGTTTCTCATGTGAGGGAGAGGTAC[G/T]AGCACAGCCATCCACAGGACGACTGGAGGTGAGTCACTGTTTTAATGTGC
Long Flanking Sequence:
GTTTTTTAATACTAGGAGTCAAAGATATCTGTAAGGAAATAGAAAAAATAACGTCCATAATGTGTAATTCATCAAAACTCATCATGTGACTCACAGTTCATCAGTTCTTCCCTCCTGGCTCATGCATTTTGCAATTTGCATAATAAATTAAATAACAGTTTTTCTGTCTTGTTAGACATCATATATTATGCTTCGGGAGACTCCATTTCCCTCTCTTACATTTATTTGAACTTACTGACCCATTACAGTACACATTTAACACAGAAGGATTCAAATGAAACTCATCTGGCTTCGAATTTACTGTGCTCTTACTTTATAGAGTCATACTGTACATGTTGTCACTCGTATATTTGTGTTTTCAGGGCATTATACAGAAGATTTTAGACATCCATAAGGTGAGGTGCGTGTCCTGCTTCGGTCTGCGCTTGAGTCATCTGAGAACAGGAGAAATTCATTGGCTTCATCCAGACATGGGCGTTTCTCATGTGAGGGAGAGGTAC[G/T]AGCACAGCCATCCACAGGACGACTGGAGGTGAGTCACTGTTTTAATGTGCCGATTACAGAAGCATAAAAGCATTGTTGAAGCTCAGGGAACATGCCCTTTGACCTGTTTCCCTTTTTAGTTGGTGCTATGTTGAGAGCATGTGATCTGTTGCTGTTTTACTCTGATAATAGTTCAGGGCAGGTCTGGTTTTTTTTATTTTATGAACGCTCACCTCTGCAATTGGATAATAAAATAGATAAAGAAAGTAATCTCCTAATTATCACCATTCTCTTACAGTTCTAAAAGTTAGAATTGGGATTTGCGAGATAGAAATGTACCATTATAAAATGCGTAAAATTCAATTTTTGCAATTATTTGCACCCATGGTAAATATGAGCAAAGAAAGCATTTGAAAATGAATGTTTTGGGTTTTTTTTGTTCAATAGAAGTTTTTTGCTAATATATTTTAATTCAATCTTATTTAATTACAAAATGTAAAATATAGACACACCTTTTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36174
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042716 Nonsense 155 1050 6 32
ENSDART00000122474 Nonsense 193 1088 5 31
ENSDART00000128158 Nonsense 54 280 6 14
ENSDART00000130249 Nonsense 54 280 6 14

The following transcripts of ENSDARG00000004672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 33118110)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30856625
GRCz11 16 30814552
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGTCTGGTGGTCTAATATTTCTCTATGTGTCCAGGTGAAAAGCGATTA[T/A]ATGATGGAGATTGCAGATCAAGTTGATCAAGACATAGCACTTAAACTAGG
Long Flanking Sequence:
ATTTCCTCTCTGCCAACACCACATGCATGAAACCTGTCAAGAGCACACAGTCATATTTCACACACGCACACACATATTAATTTTGTTTTTTGAGTTTTACCTAATCTGTGATTTACAAGTGGTTTAATCTTTAAAGCTCAAGGTCTGTGGTTTGATTCCTGCCATGTTACAAAGATCAAACTATATGCTTTCAATCATAAAATGCTTAACCAACAGGTGACTGATCCTTTTAGATGTCTCAGATTCATTATATTATAGTCCCACAAATCGGTTCCACTCAGCCCTTATGGGGTGATTCTTATAAAAGTCAAGCAAATGAGAAAGTACTGCAGCATCAGAGTTATCAGATTTTATAATGTTTTGGCAGTATAAACAAAGAGCAAATTTTAAATCAGTTTGTTCTAGAGGAGGAGTGAAATAATAAATAAATACCATTATTTTTTTTCCTGTATGGTCTGGTGGTCTAATATTTCTCTATGTGTCCAGGTGAAAAGCGATTA[T/A]ATGATGGAGATTGCAGATCAAGTTGATCAAGACATAGCACTTAAACTAGGCTGCCTTGAAATCAGGTACAGTATGTGTGTTTTACGTTTGGGGGTCAGTAATTCACCATTTTTTACGTGTCACAAAAAATATGAAGCATTGTTTAAAACTGTTTCCATCATTGATTTAAGTAAGAATTTTTAAAGCACCTAATCATCATATTAGAATTATGATGTGAAGACTGAATAAATGATTCTTGATTATTGTAATAAAAGTTTGATTTATTACTGTATTCTTTTAAAAGAAAAAGAAATATGTATTAGAGAAATTTCTGTTGAGCCATATGCTCTCAGTTTAATGAATGGTAGTGTAGATATGTTATCCCATGACTTTTAACAATTACTGACCAATTTCACATAAACTACTTTCTTCTCTGTTTCAGGAGGTTTTTCAGGGACATGCCTGGTAATGCCCTGGATAAGAAATCAAATTATGAATTATTAGAGTAAGTACTTTAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36173
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042716 Essential Splice Site 395 1050 15 32
ENSDART00000122474 Essential Splice Site 433 1088 14 31
ENSDART00000128158 None None 280 None 14
ENSDART00000130249 None None 280 None 14

The following transcripts of ENSDARG00000004672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 33104107)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30842622
GRCz11 16 30800549
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAGCTGCTCCTGCTGCGCTTGGACTTAAAATACTGTTTTTCCCTTTTC[A/G]GAAACGGACGACTACGCTGAGATCATAGACGAAGAGGACACTTACACCAT
Long Flanking Sequence:
CCTGAATTAGACAATGCCTCCTTTGCATATTCAACAATATTCAATGATATTATAAAAAAGCATTTTATCCAATAAATGCTTGCAATACGTTGTGTATTAACCAGGGAGTTATTGTAGAAACTGTTAATTATTATTGCCCATTTACAAATGAGGACAGAACATAATATCTGTCAGTTTACCCATGACTTCATCTGTTTTTCCCCAATGACAGCAGTGATTTGGAAAGAAAGTTCCCTCTTTCGGCCAGATGTACTCGCTCTTTAAACACACTCACAAATCACAGCTGTGCAGATTTGATCGAAGCCAATTCCAGCTCCTCTGAATACACACACACGAAACACTTTGTCTTAGCGCTGCTGCGTTAATGGGAAAGAGACTGTGTGTGTCGTGGGCAGTGTGTGAGATGTGCCGAATACGACTAGACTTGGTTCTGCTTTTGGAAGGGCTGTTTTTAGCTGCTCCTGCTGCGCTTGGACTTAAAATACTGTTTTTCCCTTTTC[A/G]GAAACGGACGACTACGCTGAGATCATAGACGAAGAGGACACTTACACCATGCCTTCCAGTGAGTATCACAACTTCATACTGATCTCAGACCTGGCTTCAGAATTCACTCTAAAACGTTTTTAAATCAGCAAGAAGTAGATCTATTTTCTGCTTTTGTATCCATAATATATCATTTATAAACTCGTTTATGAAATCCAGGATGGTATTCTGTGAATATTTTAAATTGATTGTTTTAATTTTGTATTTTTATTGAGTTTTTAAACAGTATAAATTAGTCTGCCAGTTTTCCCAGAGGATGATAGACATTTTCTAGAATAGAAGTCATGCTTTTAAATAATATGAAAATTAAAAAAAAAAACTTTTAACTTTTAACAATTTAATTTTTTTTTGATCAAACCAATTATTTAAAAATATATGCTGTTTTATTTATATTAATTACATAAAGTTAACTTCTACATACAATGCAGATAACACATTACAAAATATAAAATTATTTTTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28688
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042716 Nonsense 479 1050 18 32
ENSDART00000122474 Nonsense 517 1088 17 31
ENSDART00000128158 None None 280 None 14
ENSDART00000130249 None None 280 None 14

The following transcripts of ENSDARG00000004672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 33094023)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30832538
GRCz11 16 30790465
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACAATTATTTCCTTAAAATCTTTCTTTGTTCCTGCAGTGACAATGCGA[C/T]AGTTCGATCACCCTCACATTGTAAAACTGATTGGAGTCATTACAGAAAAC
Long Flanking Sequence:
TTTTAAAGTATTTTAATCTTTAACTTCGTTTTTTGGATAAAAAAATCTGTAAAATAATGTAATGTTCAGAAATAATTATTACCATTTAAAATGACACTTTTTCCTGTTTTAACATGATTAAATTGCATTAAATGTAATATAAAAATGTCACTGGCTTTTTTAAAATGTCACTGGAATTTGAATTTTTCAGAATTTATTGGGTTATAACGTTGATTTGGGGTTTAAAAGATATTTAGTATTAATATCAATTTTGAAAAAAGTTTAAAAAAATTCAGGATAATTTGATGCATTGAACATAATATCAAGATATAACATTTAATTTTTTTGTTACATTTTTAAATATCTTTACTGACACTAGATTAATTAAATGTATTATAAATTAACATTAAGCTTATTTCTCAAAAAATAACCAAATTCAGTTATCATTGAGATATTATAATAAAATTGGCATAACAATTATTTCCTTAAAATCTTTCTTTGTTCCTGCAGTGACAATGCGA[C/T]AGTTCGATCACCCTCACATTGTAAAACTGATTGGAGTCATTACAGAAAACCCAGTGTGGATCATCATGGAGCTGTGCACACTGGGAGAGGTGCGTTTTTTTTTTTTTTTTTTTACATCCCAATTTATTCTGGTTAATATGTAGCAGTAGGATTTGGTTTTGGTGGGAGGGCTTTGAACAGGTCTTAAATCTCCAAGGGAACGTGACCTGGTATTAAACGCATTAAACTCACATTATTCACCAAGATGCCAGCCGGGTTAAAGCTGGAGAAATCCATCACTGCTGCTTGTCTCATAAACGGGCCATAAAGGCGTAGTAAAGATGATTGCTGGTGGTGGCCGTTTGTCAAAGTCTGTCTCAGATGATTCAGTCCAACAGAGACACACTGTGAACCGAGCTTTCTATAGGAAAACAGTTACCTGCTAAATATCTGAAGAAAGTTTGGATTTCGTGTCTTGTGGCAACTTTTAGGTCATGCTTTCAGCTTAAGGTTTCTGTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22874
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042716 Essential Splice Site 581 1050 None 32
ENSDART00000122474 Essential Splice Site 619 1088 None 31
ENSDART00000128158 None None 280 None 14
ENSDART00000130249 None None 280 None 14

The following transcripts of ENSDARG00000004672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 33091424)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30829939
GRCz11 16 30787866
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGACTTTGGGTTGTCGAGATACATGGAGGACAGTTCTTATTATAAAGG[T/C]ATTGTGGCACTGTCAGCATATGCTTATTTGGAAGAAATTAAACTTTTATT
Long Flanking Sequence:
AATCTTGTGAGTTATACAACAGCACCATCTAGTGTTCAGCTTAGTCTTCATGGCTGTTTCAGTGTTTTTGCTGATACTGTATATTTTCTCTCGTTTTTTTTCAGTTGCGTTCCTTTCTTCAGATTAGGAAGTACAATCTGGATTTAGCATCACTCATACTGTTTTCTTACCAGCTCAGCACAGCTCTTGCTTACCTAGAGAGCAAACGCTTTGTGCACAGGTAAATGTCCACGTCATGCAAATACTGCAGCAGTTCTTCGTTCTTGTTGATTGTTGTTGAAGGACTCTTAGGATCCTTATCTAATAGCAGTTCTTCATGCATTATTCATCGCTCTGAAAGTGAATGTAGTGCTGTTCTTAAATGTGTCTACTGAGCATTTTCCTCACGTCTTTTTCAGGGATATTGCAGCACGAAATGTTCTTGTGTCTTCAGTGGACTGTGTGAAACTGGGAGACTTTGGGTTGTCGAGATACATGGAGGACAGTTCTTATTATAAAGG[T/C]ATTGTGGCACTGTCAGCATATGCTTATTTGGAAGAAATTAAACTTTTATTCAGCAAGGATACATAAAATTAGAGGGATCCCTGCTGAAAAATCCAGCTTAAACCAGCCTAGGCTAGTTGGCTGGTTTTAGCTGGTTGACCAGGCTGGTTTTAGAGAGGTTTTGGCCACTTCCGGCCTGGTTTCCAGCCATTTCCAGCCTGGTCTTAGCTGGTCAGGCTGGGAGATGACCAGCTTGACCAGCCTAGCTAAGCTGGGGGTCTAGCCAAAACCAGCTATGTCCAGCTTAAACCAGGCTGGTCAAGCTGGTTTTAGCTGGATTTGGCTGGTCATTTTCAAGCCTAACCAGCTAAGACCAGGCTGGAAACCAGCCTGGAAATGGCCAAAACCCCTCTAAAACCAGACTGGTAAAAGCTGGATTTTTCAGCAGGCATGAATGGCCTGAAATTGTGTTTTATTTTCATTTAAGGCTCTGTATTAGAAGGATTTTTAAGGATCATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13179
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042716 Essential Splice Site 795 1050 None 32
ENSDART00000122474 Essential Splice Site 833 1088 None 31
ENSDART00000128158 None None 280 None 14
ENSDART00000130249 None None 280 None 14

The following transcripts of ENSDARG00000004672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 33060833)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30799348
GRCz11 16 30757275
KASP Assay ID:
2260-9863.1 (used for ordering genotyping assays)
KASP Sequence:
TTGNNNNNTTGGTTGTGGTGTGTTTTAGCATRYGTTGATGAGAGTTTTGTGTTTC[A/T]GGATGRTGTGGCTCTGCGTGGAGGTCTGTCTCAGCTGATGGAGGARCAGT
Long Flanking Sequence:
GTCATTCTATAATGAAATCGTTTAAATTGTAATGTAAACTAATTACACTTTGCTACTTTCTTCCAAATTACATTTGTTAGAATTTTGTTTAAAAGTTTTAAATTATTCAACATGTATTAACATTTAGCATGGTACAATGTTATTTAATTGCTTTTAATGAGAAAAACACCAAATATTTTATTATTTATTTATTTATTTGATTACCTAAATTTATTATGCTCAATAATTATCTTTATTTCACACATTTCATTAATTTGTTTTTCACAAATGGTATTAGATTTTTTTTTATGTGTGCAGTTTATTTTTTACGTTTTATTTAATGTGGACAAGGGGTGTTTTATTCTCTTCCATGCATTCATGAAAATTCATAAACATTCTACTATAATTGTAATTTTGGGGGGCATTGTCCCTTTTAACATAAAGGGTGCTGAGGTTTAGTAAAAGGTTGAGTTGTTGGTTGTGGTGTGTTTTAGCATATGTTGATGAGAGTTTTGTGTTTC[A/T]GGATGGTGTGGCTCTGCGTGGAGGTCTGTCTCAGCTGATGGAGGAGCAGTTAATTCTGCAGCAGCAGCAGATGGAGGATGACCAGCGCTGGCTGGAGCATGAGGAGAGACTACTGGTACTCATTCTTCCATCTTTACCTCACATTCATCTTCATTCCCTCTCTTCTCAGCACTTTGACATATCTGTTAGTCTTCACTTTTTTCTAAAACGTTTTAGCGGTGAATCATTGTATAGTCACAGCAGAGGTATGTTATCCCAAAACAGTTTTTTTTTAATGTTTGGAAAATAAGTGTTTCCAAAGATTGTGGTTTCTTGTTAAATTTATGTGTAGAAGAAGGTTTCTGATAAATTGCGTTGTTGAAGATCTGCTTGAAGTATATGAATAAGGAATGATTTAGAAGGCATTGCACTCTGGGGAGTGTTTTATTGTTACAGTGATATGTGTGCAAATGCATGCTTTTTTTCTGGAGAATATTTGTGTGTGTTTGTGGTATGCCAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7795
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042716 Essential Splice Site 867 1050 29 32
ENSDART00000122474 Essential Splice Site 905 1088 28 31
ENSDART00000128158 None None 280 None 14
ENSDART00000130249 None None 280 None 14

The following transcripts of ENSDARG00000004672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 33051694)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30790209
GRCz11 16 30748136
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTGGCACTTTTYAGTGCAGGCTGACTTACAGACTTTCTTGTCACCCACA[G/A]AGCATGCAGCCCCTCCTAAAAAGCCCCCTCGTCCCGGAGCTCCAAGYCAC
Long Flanking Sequence:
TTGTAACTTGCTTTAAATATTTGTATTTTATTTATCAATGTGATTGGCTAGAGATAGTAGATGGAAATCAGCAGACTGGCACATTAAAAAGTAAAACTACTAATGAGTACTTTATGAGTGTCAGTTAATACTACTGACAACTTTAACTTAGTTTAATGCTTTGAAAGCTATTTCTTTACTCTTCTTTACACTTTTTTCTCCTTCTTTATTCACACATTTTTGGAAAGTGATGGTACTTTTGCTTGAGCACTGTTGGTTTACATTTTCCATCTGTTTGTGGTCATATGATGTTTTTCTTTTTATCTCTATTCATTCAAAAAGAAAACAAATCAAAGTGACCTCAAACTTTTGAATGGCAGTCTACAGTACATACTACTTTGTGCTGATGCTTTATAAATGTCAGCGTATGAAAGTATCAATTTGGGCCTCTTGAAAATGTATTTTTCTGATGTTGGCACTTTTTAGTGCAGGCTGACTTACAGACTTTCTTGTCACCCACA[G/A]AGCATGCAGCCCCTCCTAAAAAGCCCCCTCGTCCCGGAGCTCCAAGCCACGCAGCAGGAGTCTCTGGCCTCAACCCTACCGAGAGTTACAATGAAGGCGTCAAGGTACCAGAATTATCTAAACTTAGCTTTTTTACAGCTTCAAATGACCATTGTGCATCTATAACTTCACATAGACCAATGTGCGCTGTTTTTAAACCACATAAAGTTTGAAACGCGCACACACACACACACACACACTCTCTGAGAGGCTGGTAAGATTAGCATCTGCACTCACGGGTCGCCTTCAGGAGCAGTTAGCATGCCAACAGATGCTGTTTGCCAAGCCTCATTAAAATCATCCTCATTCCTGAAAACCTCTTTTCAAATATACACACACACACATACACACACACACGCACAATTGTTCAGCGGGGTCTCTCATAAAACAGATCCCTGCACACCGAGAACCCCGGCAGTTTCCATTCCTGCACATTTTCCTGATGCTGTTGGTCGCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22873
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042716 Essential Splice Site 902 1050 30 32
ENSDART00000122474 Essential Splice Site 940 1088 29 31
ENSDART00000128158 None None 280 None 14
ENSDART00000130249 None None 280 None 14

The following transcripts of ENSDARG00000004672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 33044304)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30782819
GRCz11 16 30740746
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATCTTCATTAATCCATCATTTAAAAAAACTTGTATATGTTCTTGTCTA[G/T]ATTCAGCCTCAGGAGATCAATCCACCACCAACGGCTAACTTGGATCGCTC
Long Flanking Sequence:
ACACTCTAGGGACATCAGAAACTTATTTTACATCTTGTAAACAGGTACATAATAGGTTCCCTTAAAAAAAGATTCTAATATCTAAATAAATACAAGTTGCATGGAAATAGATACTTGTATATTTTATAAGTTAAATGCTAAAACTGCTTGCCAAATTCTTTTTCTTTTTATTTATTGTAGCACAAACTAGTAGAGGTTTTGAATCATTCTGTGACTAGTTTGTAAAAGGTTTTCTCATTTTGTCATCACATCTTATTTTGTATTCAAATCAACCAGTGCAGACTAATATTGAATCTGCTCATATTGTGGGTAGTGATGGGTCTCAGTAGTTGCTTGTATTGCCATCTAGTGTCAAATTTGTACCATAACACAAACCTCTCACTTGATCATCACATAACATGGACTCAATAACTCAAACCTTCATCCTAAATCCTTTGTTTATATGCATAGGAATCTTCATTAATCCATCATTTAAAAAAACTTGTATATGTTCTTGTCTA[G/T]ATTCAGCCTCAGGAGATCAATCCACCACCAACGGCTAACTTGGATCGCTCCAACGATAAAGTGTATGAAAATGTGACAGGACTGGTGAAGGCAGTCATTGAGATGTCCAGTAAAATCCAGCCTGCGCCGCCTGAAGAATACGTGCCCATGGTGAAGGTACAACACAAACTGAGAAATATGTTATATGTTTACTATAGTCACTAAACATGTTTTTATTAATGATTTTAAAGGGGTTGTTCATCCACAATTTAACATATTACCATAATTTACTCTTGTTGTACCAAACCTCTAAGGCATTCGTTCATCTTTGGAACACAAATGAAGATATTTTAGATGAAATGCAGGGGCTCTCTGGCCTCCATAGACACCAAGAGTCCCAAGATGTTCAAATTTGAAAAATGGAACCAAAAAAACTATTATTAGTATTAATGTTCCATGTGACTTTAGTTGTTTGGCTGTAATCATACAAAGTTTTTTTTGTTAGCTAAAGTCTGGTCTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3963
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042716 Nonsense 1014 1050 32 32
ENSDART00000122474 Nonsense 1052 1088 31 31
ENSDART00000128158 None None 280 14 14
ENSDART00000130249 None None 280 None 14

The following transcripts of ENSDARG00000004672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 33041459)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30779974
GRCz11 16 30737901
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAATGAAGTTGGCCCAGCAGTACGTCATGACAAGCCTACAGCAGGACTA[C/A]AAGAAACAGATGCTAACAGCTGCGCACGCGCTCGCCGTAGACGCCAAGAA
Long Flanking Sequence:
ACACAGCTTTAGGCCAAGTTTGGGGCTTGGTATTAGTCTAAGAAGACAGAATAATAATTATATGTTTGAGTAGGATAACAATTAGTTGGCTCTCTCAAGCCTACATAATTATGTAGTTAATAATCAAATTTTTTTTTTGAAATAACTTACTCAACACTGACAATGACAGCCTTTCATTTTTGTAGCATTTTTGTGATCTCTACACTTTTCAAAATGTTTCAGGAAGTGGGATTAGCACTGAGAACATTATTGGCCACAGTGGATGAGACCATACCTTTATTACCAGCTCACACGCACAGAGAGGTAAACAAGTTCACACGCTAGCCTCAAAATACCAATACTCATACTCCGTTTCGTGCCCAGCAGCTTGACTAACTTACTCATGTTCCATCTGCTCAGATCGAAATGGCCCAGAAGCTTCTAAATTCAGATTTGGCTGAGCTGATAAATAAAATGAAGTTGGCCCAGCAGTACGTCATGACAAGCCTACAGCAGGACTA[C/A]AAGAAACAGATGCTAACAGCTGCGCACGCGCTCGCCGTAGACGCCAAGAACCTGCTGGATGTGATCGACCAAGCCAGGCTGAAGTTGTTGGGCCAGGCGCGACCACATTAGCCCCGCAAAAGAGGACACGTAGACGCACGTGATGAACACACACACACCAGCACAGACTTGTACACTAATAACGGAGTCTCATGAGCCCCCTTCACTACTCACCCACCCTCACGTTAAGCTACCGTGAGCCGGGCTCTGGATTTATTTAACGGATGAGCTGGACCAGACTGGATCTCTATGAGGACGGTGACCGGATGCTGACAGGGGCGATTCTGAGCTTTAAAAACGTCTCTGGAGGGAAAAAAGAGACACTCTTACACTGTATCTAATATGTCTGTGTTTCATTGACTGGGACTACACTAATCTAGATCCCGCTCCGCTCGGGTTCTAGTTGGGAGATCGTAGAAGACTGTTTTGCACAGTAGAACTGGAGAGAGAGGTCTCAGTTG
Associated Phenotype:
Not determined