Busch Lab

ZMP

cdhr1

Ensembl ID:
ENSDARG00000004643
ZFIN ID:
ZDB-GENE-040924-4
Description:
Cadherin-related family member 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6B3P0]
Human Orthologues:
CDH23, CDHR1
Human Descriptions:
cadherin-related 23 [Source:HGNC Symbol;Acc:13733]
cadherin-related family member 1 [Source:HGNC Symbol;Acc:14550]
Mouse Orthologue:
Cdhr1
Mouse Description:
cadherin-related family member 1 Gene [Source:MGI Symbol;Acc:MGI:2157782]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa9596 Essential Splice Site Available for shipment Available now
sa35513 Nonsense Mutation detected in F1 DNA Not yet available
sa15425 Nonsense Available for shipment Available now
sa1445 Nonsense F2 line generated Not yet available
sa9583 Nonsense Available for shipment Available now
sa35512 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6307
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026679 Nonsense 26 856 2 17
ENSDART00000110005 Nonsense 27 857 3 18
Genomic Location (Zv9):
Chromosome 13 (position 29728595)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29374543
GRCz11 13 29504993
KASP Assay ID:
554-4550.1 (used for ordering genotyping assays)
KASP Sequence:
AGGTTATGCTAATCTGATGTCTGCTTGTTGTTTATAGCACAGAGTGACTA[T/A]GCACCCTATTTCTATGATAATGGGCCCAACAGTAACAACGGAAATATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9596
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026679 Essential Splice Site 119 856 4 17
ENSDART00000110005 Essential Splice Site 120 857 5 18
Genomic Location (Zv9):
Chromosome 13 (position 29726158)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29372106
GRCz11 13 29502556
KASP Assay ID:
2260-6529.1 (used for ordering genotyping assays)
KASP Sequence:
CACAAGATGAGATTGAAGTCTTTGTCAGCATCTCTGATAGCCTTAATAAA[G/A]TAAGTATTACGACTGRKTAAGGACTCGTATATCAGTACCAGAGATGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35513
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026679 Nonsense 134 856 5 17
ENSDART00000110005 Nonsense 135 857 6 18
Genomic Location (Zv9):
Chromosome 13 (position 29726038)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29371986
GRCz11 13 29502436
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGTCAGGTAGTTGAAAAGGTTTCAGTTTTTATCATGGATGCCAATGAT[G/T]AGAGACCACAGTTTCAAAACATGCCTTCCATCGTAGATGTGCCAGAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15425
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026679 Nonsense 229 856 8 17
ENSDART00000110005 Nonsense 230 857 9 18
Genomic Location (Zv9):
Chromosome 13 (position 29722989)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29368937
GRCz11 13 29499387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AWAAATTATTKYGTTTTTAGGATGGAGGAGGCATTTACAAGGGCAAGCAA[C/T]AAGTGATGTCATCATCTGCTACTTTGACCATAAATGTGATCGACACTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1445
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026679 Nonsense 276 856 9 17
ENSDART00000110005 Nonsense 277 857 10 18
Genomic Location (Zv9):
Chromosome 13 (position 29721308)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29367256
GRCz11 13 29497706
KASP Assay ID:
554-1371.1 (used for ordering genotyping assays)
KASP Sequence:
TTAAGATCTAATTTTGTCTACAGGGATCTGAGATATTTACAGTTTCTGCC[A/T]AAGATGGAGACATGGATAATCCAAATACGATCATATATTCATTGGACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9583
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026679 Nonsense 439 856 12 17
ENSDART00000110005 Nonsense 440 857 13 18
Genomic Location (Zv9):
Chromosome 13 (position 29719878)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29365826
GRCz11 13 29496276
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAAGTCACYGTCCTAGTGGAGGATTCTGCWGCAATGGATTTTGAGAAAT[C/A]ACAGTTCCTGACTTTTAAGGTAGAAKTTTTTTYGTTTCACAGCTGTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35512
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026679 Nonsense 552 856 15 17
ENSDART00000110005 Nonsense 553 857 16 18
Genomic Location (Zv9):
Chromosome 13 (position 29709493)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29355441
GRCz11 13 29485891
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCCTTGGGCCAGTCTGGATGCTGAGGTCAAATCCAAGTATAACTTCTA[C/A]GTGAAAGCCGAAGACCCTGAAGGAAAATACAGCCTCGCGGAAGTCTTTGT
Associated Phenotype:
Not determined