Busch Lab

ZMP

si:dkey-263o8.2

Ensembl ID:
ENSDARG00000004627
ZFIN ID:
ZDB-GENE-091204-114
Human Orthologue:
PANX3
Human Description:
pannexin 3 [Source:HGNC Symbol;Acc:20573]
Mouse Orthologue:
Panx3
Mouse Description:
pannexin 3 Gene [Source:MGI Symbol;Acc:MGI:1918881]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa12358 Nonsense Available for shipment Available now
sa10093 Nonsense Available for shipment Available now
sa34934 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12358
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027288 Nonsense 80 444 2 5
ENSDART00000146116 Nonsense 80 444 3 6
Genomic Location (Zv9):
Chromosome 10 (position 32019738)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31121087
GRCz11 10 31007427
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGATTAGCTGCTTTCCTCCCAATAACTTCACAGTGAAGCAGGCARCCTA[T/A]GTGGACACGTACTGCTGGGACTCGCTCATGCACCAMGAGTTTGACACCGA
Long Flanking Sequence:
TGTGGTCTCAGACTTTTGGAGCCAACTATATAAATTTTCATAAGTAGATCACGATTAAAACGTTAAGGAAACTCAGATGTCTATTAATATCTCTGCTGGTTTGCTATCATGTAATTAGCAGAGATGTTCTGCAGCTCAGTTGTCTATAATAGCGGTGGGTGTGGGGCATCTTGGGTTCAGGCAGTAAATTGAATGTTGACTGTAGGTTTTGGAGAGCGGCACACACGTTTAACTGGTGCAGCTGGGTCACACCCTCTCACCCAGCCAGCAAAATCTCTTCCAGATGGGTGTTTCTTGGTGGTTTCAGGATCTGTAGATGGAGCTTTATTACAGACGTTACCACCCAGCTCTTGGCCAGCTTTTCTCCACTTATACAGCAACAAGTGATGCTGGAACACTGTCATTTCTGCCTCAGCATGTTCATTTTCTCTGCTTCTTCCTCCAGGCCCACAGATTAGCTGCTTTCCTCCCAATAACTTCACAGTGAAGCAGGCAGCCTA[T/A]GTGGACACGTACTGCTGGGACTCGCTCATGCACCACGAGTTTGACACCGATGGAAACATTGAGGAACGCTCACTGTGGGTTCATAAAGTGAGTAAGAAATGTACAATCACAGTTTTTGTTTTTTTTATTTATATAAAAAAGTCATTAAATGGAGATGAAATGAAAGCTTTTTTTGAGGTTCTTGCTTTTTTTTTTTATACTTAGACCGGGACACACAAGTGTTTTATGTGGACTTTAAGACGATATTTTAAACTGCGAACTGACTTGCAGTGAAATCAATAGCCAGAAGTTTGAATATGAATTAGAAAAAAAACTCTTTATCTCTTCTTTTTTTAATTTCATGTTTATTTGTGTCCATATTAAAACTTTTGACCGTTCATTCATTCATTTTCTTGTCGGCTTAGTCCCTTTATTAATCTGGGGTCGCCACAGTGGAATGAACCGCCAACTTATCCAGCAAGTTTTTATGCAGCGGATGAACGCAGGGAGAACATGCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10093
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027288 Nonsense 131 444 3 5
ENSDART00000146116 Nonsense 131 444 4 6
Genomic Location (Zv9):
Chromosome 10 (position 32017784)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31119133
GRCz11 10 31005473
KASP Assay ID:
2260-3386.1 (used for ordering genotyping assays)
KASP Sequence:
TTATTGGTGATGGCCATGATGATGTACCTGCCGGCTCTRATCTGGCGCTA[T/A]CTGGCAGTCCCCAGCCTGACCTCTGACCTGTTTTTCATCATYGAYGAGTT
Long Flanking Sequence:
CTTCAGCTTAGTCCCTTTATTCATCACTGTTCACCACAGCAGAATGAACCACCAACTATTCCAGCACGTCTTACACAGTAGATGCCCTTCCAGCTGCAACCCAGTACTGAAAAACACCCATACTCTCACATTCACACACTCATACACTAAGGCCAATTTAGTTTATTCAATTCACCTACAGTAAACCTGCATGTTTTTGCACTGTGGGGAAAACTGGAGCACCTGGAGAAAACCCACGCAAACACTGGGAGAACTTGCAAGCTCCACACAGAAATGCCAACTGACCCAGCCTGGACTCGAACCAACGACCTTCTTGCTGTGAGGCGACAGTCATAACCACTGATCCACCATGTCGCTAATGCATATTAATATACTGAGTCACTATATTTGTCTTGACTATTTACTTTAGATAAATGTTGTGTTGTTTTTTTGCAGATGTTTCCATACTCCTTATTGGTGATGGCCATGATGATGTACCTGCCGGCTCTGATCTGGCGCTA[T/A]CTGGCAGTCCCCAGCCTGACCTCTGACCTGTTTTTCATCATTGACGAGTTGGACAAATCATACAACCGCTCTGTCCGTCTGGCCCAAAACATCCTGGACCTGAAAGAGCATTCAGAAAGCGCTCTGCAGTTCCAGACTGAGCTCGAGAGGTACTTATGAACAGTTTTACTTCTCATTTTAAGGTGAGACACTACTGATGAATAGGAGGAAAAACAAACTAGTATTAATCACCATACTTCACATTACATTACAGATTGTAAAAAAATTTTTAGAATACAATTTTTCTAAAATGCTATTTTTAAATTAGTTTAAATTAGACAGTATGCGGCAAGTTGGCTCAGTGGTTAGCACTGTCGCCTTACAGCAAGAAGGTCGCTGGTTGGAGTCCCAGCAGGGCCCGTTGGCATTAACTATGTGGAGTTTAAAAGTTCGCCTGGGGTTTCATCCAGGTGCTCCGGTTTTACCCACAGTCCAAAGACATGCACTATAGGTGAATTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34934
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027288 Nonsense 294 444 4 5
ENSDART00000146116 Nonsense 294 444 5 6
Genomic Location (Zv9):
Chromosome 10 (position 32015261)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31116610
GRCz11 10 31002950
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGGAGCCGTCTATGTGCTGCTGGCTCCTATTGTCCTCTTCAGCCTGCTT[C/T]GATTGTTTTGCTGGGACACCACCTTTCTTTCCCTGTACGAAGTGCTTCCT
Long Flanking Sequence:
GTGATCATAATTGAAATCTACACGACAAAAGAAAATTAGGATGTAAAAAATAAACAAAGCAAATCTAGAGTGTTCCGCAGTGTCATGCATTAAAAGCAAAGTGTGTTCTTTAGATGCATAAAACAATGTATTACTATTATTATTATTAATTTTATCTCTTCAGAGCCAAACGCAAGCGATACTTTGAGTACCCCCTGCTGGAGAGATACATGCAGTGCAAACATGGCTCCTACTTCCTGGTCAGCATGCTGTTCCTGCGAGGGTTCCTCCTCCTGACCTTCATGTCCGCCTCGTGCCTGTACCTCATCTACTTCCACCTCTCTTCATTCCTACAAGACGAATTCAGCTGCTTCGTGCGGACCGGCCTCCTCCGCGACCAGCCATGGGTCCCAGAGCTAGTTCAGTGTAAAATGACCGGTCTACTTGTGTTTCAGGTCATTAGTGTGGCTAACGGAGCCGTCTATGTGCTGCTGGCTCCTATTGTCCTCTTCAGCCTGCTT[C/T]GATTGTTTTGCTGGGACACCACCTTTCTTTCCCTGTACGAAGTGCTTCCTGGACTGGGGCTGATCAGCGGTCAGAAATTGGGCTGCCCACTTAATGACCTCAATGTTTTGCTCCTGTTTTTGCGCGCCAATGTAGCACAGCTGCAGTCGTACAGCCGTCTAAGGGCCATCTGCTCCCTTGCACCTCCTCGACTGAAGGGCGCTAAAGGCGTCCTGACGGAGGAACAGGCAGAGGAGATGCTGGAGACCGCAGAGGAGCTGGAGGAGGAGATGAGGGAGGCCAGAGAGGAGGGAAAACTCAATCTGGTGGACATCATGACTGTCCTGGGAGCAGCTCGAGGAAATGCAGTCAACTGTCCAGAGCAGCGCCCTCTTGTGGAGCCTGACATGACGCTCGGTACAGTCACACTCATCTATGTACTTAAACGCATCTTGCTGGTGGCCATTTTTGTGGCTGTCATTTGGGACGTTCAGAAAATCATCAAGTGATGGAGAGATATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3761
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027288 Nonsense 298 444 4 5
ENSDART00000146116 Nonsense 298 444 5 6
Genomic Location (Zv9):
Chromosome 10 (position 32015247)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31116596
GRCz11 10 31002936
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGCTGCTGGCTCCTATTGTCCTCTTCAGCCTGCTTCGATTGTTTTGCTG[G/A]GACAYCACCTTTCTTTCCCTGTACGAARTGCTTCCTGGACTGGGGCTGAT
Long Flanking Sequence:
AATCTACACGACAAAAGAAAATTAGGATGTAAAAAATAAACAAAGCAAATCTAGAGTGTTCCGCAGTGTCATGCATTAAAAGCAAAGTGTGTTCTTTAGATGCATAAAACAATGTATTACTATTATTATTATTAATTTTATCTCTTCAGAGCCAAACGCAAGCGATACTTTGAGTACCCCCTGCTGGAGAGATACATGCAGTGCAAACATGGCTCCTACTTCCTGGTCAGCATGCTGTTCCTGCGAGGGTTCCTCCTCCTGACCTTCATGTCCGCCTCGTGCCTGTACCTCATCTACTTCCACCTCTCTTCATTCCTACAAGACGAATTCAGCTGCTTCGTGCGGACCGGCCTCCTCCGCGACCAGCCATGGGTCCCAGAGCTAGTTCAGTGTAAAATGACCGGTCTACTTGTGTTTCAGGTCATTAGTGTGGCTAACGGAGCCGTCTATGTGCTGCTGGCTCCTATTGTCCTCTTCAGCCTGCTTCGATTGTTTTGCTG[G/A]GACACCACCTTTCTTTCCCTGTACGAAGTGCTTCCTGGACTGGGGCTGATCAGCGGTCAGAAATTGGGCTGCCCACTTAATGACCTCAATGTTTTGCTCCTGTTTTTGCGCGCCAATGTAGCACAGCTGCAGTCGTACAGCCGTCTAAGGGCCATCTGCTCCCTTGCACCTCCTCGACTGAAGGGCGCTAAAGGCGTCCTGACGGAGGAACAGGCAGAGGAGATGCTGGAGACCGCAGAGGAGCTGGAGGAGGAGATGAGGGAGGCCAGAGAGGAGGGAAAACTCAATCTGGTGGACATCATGACTGTCCTGGGAGCAGCTCGAGGAAATGCAGTCAACTGTCCAGAGCAGCGCCCTCTTGTGGAGCCTGACATGACGCTCGGTACAGTCACACTCATCTATGTACTTAAACGCATCTTGCTGGTGGCCATTTTTGTGGCTGTCATTTGGGACGTTCAGAAAATCATCAAGTGATGGAGAGATATTTAACATTTGAAGAT
Associated Phenotype:
Not determined