Busch Lab

ZMP

nmnat2

Ensembl ID:
ENSDARG00000004580
ZFIN ID:
ZDB-GENE-030131-8201
Description:
Nicotinamide mononucleotide adenylyltransferase 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6PC93]
Human Orthologue:
NMNAT2
Human Description:
nicotinamide nucleotide adenylyltransferase 2 [Source:HGNC Symbol;Acc:16789]
Mouse Orthologue:
Nmnat2
Mouse Description:
nicotinamide nucleotide adenylyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:2444155]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa39877 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44539 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39877
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003550 Essential Splice Site 29 304 1 11
Genomic Location (Zv9):
Chromosome 2 (position 35761441)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36058151
GRCz11 2 36040608
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATGTGGAAGTTTCAACCCCATCACGAAGGGACACATTCATATGTTCGG[T/C]AAGTGCTCCGCCTGGGCTGGAGGGAGTGGATGCGCGAGCGGATTTTTAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3419
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003550 Essential Splice Site 29 304 2 11
Genomic Location (Zv9):
Chromosome 2 (position 35756614)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36053324
GRCz11 2 36035781
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAGGCTAAGTGTGTCACACAACATTAYAAAGWTATCCTGTTTGCTTTGC[A/T]GAAAAGGCCAGAGAGTATCTGCACAAGACTGGACGATTCATTGTGATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44539
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003550 Nonsense 271 304 10 11
Genomic Location (Zv9):
Chromosome 2 (position 35749527)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36046237
GRCz11 2 36028694
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAAAGATGAAATCGACCACACGATGTCAATCGTCAGTTCCACCAAGAGC[A/T]GGTTTGTGTTCACCTCTCTATTCTTTACCATAATGTATGGTATGTACTTA
Associated Phenotype:
Not determined