Busch Lab

ZMP

zgc:194665

Ensembl ID:
ENSDARG00000004577
ZFIN ID:
ZDB-GENE-080722-38
Description:
transmembrane protein 178-like [Source:RefSeq peptide;Acc:NP_001122218]
Human Orthologue:
AC005692.1
Human Description:
transmembrane protein 178-like [Source:RefSeq peptide;Acc:NP_001182207]
Mouse Orthologue:
Gm5567
Mouse Description:
predicted gene 5567 Gene [Source:MGI Symbol;Acc:MGI:3647581]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa44289 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5102
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026401 Nonsense 20 297 1 4
Genomic Location (Zv9):
Chromosome 25 (position 20491152)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19902070
GRCz11 25 19999724
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGAAGTGGCTTCTCTACACGGGGCTCTGTCTGTCTCTCGTCGCCTTGTG[T/A]TTCCTGACAGTCGCAATCTCTTCCGACCACTGGTACGAAACGGACGCGAG
Long Flanking Sequence:
AATTCCATAAAAATAATTCTGTCATAAAATCTGATTAAACATGCAGAACTAATCTGTGGTAAATAAAACTGCGTGTTCAAATGTAAGTTATTTTTATTTCTGCATGTATATTCGCAGTGATTTATTTAGACCAATGCAATCGCTTTCAAATAATCCTCCCTCCACCATTTTTAAATGATTTTCAGTTCCTGTGTGATTGTCATGTGTCTCTGCCTGCAGCAGCTCGAGCGGAACCCGCTCCTCATCACAGTCTACGTGTAGACCCGAGGAAATATCTCGCACAGGACGGGCTTTTGTCAAAACATCGCTTTCGTATAAAAGGGCATGTTTACCCCATTTGACTTTTTTAACGCGACGAGAGATGCTGAAGCGGGATTGATTGTTAGCCTCGCTCAAGGGAGCTGTCCAGCATGAGGTGCTGATCGGCGGCCTGGCAGAACGATGGCGACGGGGAAGTGGCTTCTCTACACGGGGCTCTGTCTGTCTCTCGTCGCCTTGTG[T/A]TTCCTGACAGTCGCAATCTCTTCCGACCACTGGTACGAAACGGACGCGAGGAGATACAAGGAGCGCTGCCGAACTTTCTCGAACCGCAGGAGCGACCCGGGCTTCATTTACATCCCCACCCACAGCCTTCCTCTGCGAGCCAGCCGAGCGAGTCTGGACCGATGGGAAGACCGACTGCTGCTCACTAGAAACCGGCGGCAGCTGTTCGCCATGAGCGCGGCGGATGAGTGCAGCAGACGCTACAATTCAACCAACATGGGGCTCTGGAGCAAATGCTACAGGGTGGGATTTGACCCAGACGTCGAAGACCTCATCAAGAATGGTAAAAAAAATACTCTTGAGGCTTATTGATGCAAAGCAAATACTGAAATAACAAAAACCCACGAATGCTATTTCATAAGCTTGACTGCTTGTATATCAAGGCCTATAGGGATGCATCGGAGCAATATGCATTTTCAGTCGTAGTCATTTGCATATCCGTATAAACAGGCATGTTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44289
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026401 Nonsense 203 297 3 4
Genomic Location (Zv9):
Chromosome 25 (position 20494341)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19905253
GRCz11 25 20002907
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGACCATTGGCCTTTTAGGATGTTGTTGGGAGCAAGGCCTCATGCATTA[C/A]GTTGCCGGTCTACTCTTTCTAATGGGAGGTATGTGTATTATTTGAAATGG
Long Flanking Sequence:
TCCGAAAGATCAACTAGAAGTCTAGTTATTATTTGTTGCTTACAACTGGGGTCGACAACAAGACTTTTGTCAGGTAGTGTAGCTGGTTGGATATAATTGTTGGCACATGCTATCACCCCAGGTGCAGGAATGGACAACTCAACCTTAAGAGTTACTGGGTTACATAAGAAATTGTCTCTAGCATATAGAGGCCCTGTAGAGTTTAAAGCAGCATTACCTAATAATGTGCCTGGAGTTGCAACATTCTTTCAGAGTTGAGTTGGTAGAAACTAATCACGGTCCTTAGGATCACAAGAAACCTTCGGGCAGGTGTGCTGGAGCAGGTAGAAGCTCATCTTGGCAATAAGGTACTCCTTCAGAACCGTTAGTAATTTGATGTTTCCTTCCCCAGATTTGCGTCGGATGACAGCTGGCTTCATGGGCATGGCTCTATCCATTATTCTCTTTGGCTGGACCATTGGCCTTTTAGGATGTTGTTGGGAGCAAGGCCTCATGCATTA[C/A]GTTGCCGGTCTACTCTTTCTAATGGGAGGTATGTGTATTATTTGAAATGGCTGCTTAACCGTTCCCCATATATTTGCTCTCTTAAGTTTTTAGAGCCTTTGAATATCTACTAACTAGTATCATGTCCCACTACAGGTACCTTCTGCATCATCTCTCTTTGCACCTGTGTGGCCGGAATCAACTTCGAATTGTCTCGCTACCCACGTTATCTCTTCAGCCTCCCAGATGATATAAGCCATGGTTACGGCTGGTCCATGTTTAGTGCCTGGGGAGGGCTGGGACTAACCCTCATTGCTGGGTTCTTCTGTACTCTGGCACCTTCGATTCAGCCTCCACCACCAACCCGTACCTCCTGTCCCAAGTCTCGTATGGAGAACGGAACAGTGTGTTAAAGAGTCACGTTAGGAGACTGACATGAACTTGTGTATAAACTTTGTCATGGGTTTTAAAAGCATGGAGCTGTTGAAAGACTCAAAGGTCACAATCCATGGCGGTTGGGA
Associated Phenotype:
Not determined