Busch Lab

ZMP

ptgs2a

Ensembl ID:
ENSDARG00000004539
ZFIN ID:
ZDB-GENE-020530-2
Description:
prostaglandin-endoperoxide synthase 2 [Source:RefSeq peptide;Acc:NP_705943]
Human Orthologue:
PTGS2
Human Description:
prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) [Source:HGNC S
Mouse Orthologue:
Ptgs2
Mouse Description:
prostaglandin-endoperoxide synthase 2 Gene [Source:MGI Symbol;Acc:MGI:97798]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa11800 Nonsense Available for shipment Available now
sa16633 Nonsense Available for shipment Available now
sa90 Nonsense Confirmed mutation in F2 line Not yet available
sa44528 Nonsense Mutation detected in F1 DNA Not yet available
sa25105 Nonsense Mutation detected in F1 DNA Not yet available
sa10104 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11800
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006870 Nonsense 14 601 1 9
Genomic Location (Zv9):
Chromosome 2 (position 20719755)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21265693
GRCz11 2 20923755
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTTCTGGAATGAATAAACTGGTTTGCTTGGTCCTACTTTCAAGCATTTG[G/A]ATCTTTCCTGGTGAAGGATGTAAGTTAAAACAAATTTMCTCTGTTAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16633
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006870 Nonsense 104 601 3 9
Genomic Location (Zv9):
Chromosome 2 (position 20719285)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21265223
GRCz11 2 20923285
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGGATATCATCAACAGCATCTCTTACCTGAGGGATGGCATAATGCGCTA[T/A]ATCCTSTTGTGTAAGTTGAATGAAATCACTTCWGCATTGGATTTCCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa90
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006870 Nonsense 162 601 4 9
Genomic Location (Zv9):
Chromosome 2 (position 20719002)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21264940
GRCz11 2 20923002
KASP Assay ID:
554-0067.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCAAAACTGCCCAACGCCTGATCTCCCAAATGCCAAGCAGGTGGTGGAG[C/T]AGGTGCTGTTGAGGAAGCAGTTCATCCCTGATCCACAGAGGAGCAGTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44528
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006870 Nonsense 167 601 4 9
Genomic Location (Zv9):
Chromosome 2 (position 20718987)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21264925
GRCz11 2 20922987
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCTGATCTCCCAAATGCCAAGCAGGTGGTGGAGCAGGTGCTGTTGAGG[A/T]AGCAGTTCATCCCTGATCCACAGAGGAGCAGTCTCATGTTTGCTTTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25105
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006870 Nonsense 218 601 5 9
Genomic Location (Zv9):
Chromosome 2 (position 20718752)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21264690
GRCz11 2 20922752
KASP Assay ID:
554-7831.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCTAAAGATTCTGTCGTGTTTTAGGTGGATCTGGGGCATATTTATGGA[G/T]AGACGCTGGAGGTTCAACACAAACTTCGTCTGTTTAAAGATGGAAAGCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3427
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006870 Essential Splice Site 320 601 6 9
Genomic Location (Zv9):
Chromosome 2 (position 20716910)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21262848
GRCz11 2 20920910
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACTGGGATGATGAGAGAATCTTCCAAACCACTCGTCTCATCCTGATTGG[T/C]GAGTCATGGYCCCATCTTCAAACGTAAGGGTGTCCTGYCCCTGAAGTTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3393
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006870 Nonsense 386 601 7 9
Genomic Location (Zv9):
Chromosome 2 (position 20715898)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21261836
GRCz11 2 20919898
KASP Assay ID:
2259-1864.1 (used for ordering genotyping assays)
KASP Sequence:
CATCCACTGTTGCCGGACAACTTTCAGATCCAGGATCAGATCTACGGCTA[T/G]CACCAGTTTGTGTTTAACAACTCTATCGTCACCACACATGGCATYCGCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3392
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006870 Essential Splice Site 415 601 7 9
Genomic Location (Zv9):
Chromosome 2 (position 20715810)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21261748
GRCz11 2 20919810
KASP Assay ID:
2259-1863.1 (used for ordering genotyping assays)
KASP Sequence:
ATGGCATYCGCAACATGGTGGACTCCTTCACCAAACAGACTGCTGGACGG[G/A]TGAGTTTCATTCAGGGTTTAGACCAGTTCACTCCACACCAAAAGTACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10104
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006870 Nonsense 527 601 9 9
Genomic Location (Zv9):
Chromosome 2 (position 20712983)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21258921
GRCz11 2 20916983
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACTCTCTCAAAGGCCTCATGGGAAATGCTATTTGTTCTCCTGAATACTG[G/A]AAGCCCAGCACATTTGGTGGGAAAGTRGGATTTGACATCGTTAACTCKGC
Associated Phenotype:
Not determined