Busch Lab

ZMP

mll

Ensembl ID:
ENSDARG00000004537
ZFIN ID:
ZDB-GENE-080521-3
Description:
histone-lysine N-methyltransferase MLL [Source:RefSeq peptide;Acc:NP_001103749]
Human Orthologue:
MLL
Human Description:
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) [Source:HGNC Symbol;Acc:7
Mouse Orthologue:
Mll1
Mouse Description:
myeloid/lymphoid or mixed-lineage leukemia 1 Gene [Source:MGI Symbol;Acc:MGI:96995]

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa42541 Nonsense Mutation detected in F1 DNA Not yet available
sa137 Nonsense Confirmed mutation in F2 line Not yet available
sa24984 Nonsense Mutation detected in F1 DNA Not yet available
sa35881 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10905 Nonsense Available for shipment Available now
sa19111 Nonsense Mutation detected in F1 DNA Not yet available
sa22638 Nonsense Available for shipment Available now
sa2815 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28448
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Nonsense 1219 4219 3 35
Genomic Location (Zv9):
Chromosome 15 (position 22755552)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23466739
GRCz11 15 23402004
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCAATAAGATAGAGAAGCGAGAGTTACAACCTGGTGATCAACCCAAAT[T/A]GCCGGTATGTCCTATCTTTTGTCACCTTTGCTTTGATAAACATTTTCAGG
Long Flanking Sequence:
TGAAAAGGAAAACAAAAGAGATGGAAGAAGAGATTGGGATAAAAGAGGGAAAAGCCTTCCATCAGAAGCTTCCCCCAGTTCTATATCTAGTTTCTTTGGTTTGGAGGCTATTGAGGAATCTCTCACCCAAAAAAGGACCCCTGGCCGAAAAAAGTCAGTCACAGTTGACTGTGCAGAGGCCTCTCCAAGTGACTCTGCAGCAGTTCAGGCTGTTGGGTCCTTGTCATCAAAGGGTCGGCTGACTAAAAAAGGCAGACCTCCAGAGAAGAGTATTGAATCAGAGGGAGTAGAGAGGGAAAAGGACAAAGAGAAACTGAGTGCCCTTACCCAAGCAGGTCAGATGGGGAAACCCCCAACAACTACATCCATAGACTCCATATTAGATCGTGCCGAGAAGCAGCCTGTTACAGACAGACGTGTTGTTAGACTGCTGAAAAAAGCTAAAGCCCAGCTCAATAAGATAGAGAAGCGAGAGTTACAACCTGGTGATCAACCCAAAT[T/A]GCCGGTATGTCCTATCTTTTGTCACCTTTGCTTTGATAAACATTTTCAGGTTTGTAAATGCAGCAAAGTTAATTTTCACTTGTTTGTCTTGTGCAGGGACAAGAAAGTGACTCCTCTGAGACTTCAGTCCGTGGTCCACGAATTAAGCATGTGTGTCGTCGTGCAGCTGTAGCTCTGGGTCGCAACCGTGCCGTGTTCCCAGATGATATGCCTACCCTTAGTGCCTTGCCATGGGAGGAGAGAGAAAAGATCTTGTCTTCCATGGGAAATGATGGTGAGAAAAGATCTTAAAACTAGTTTGATATTGTTTACAAAAGTATTGTTGTTGTAAAGTTGTTTTAAATGATGTTCTTGAATAGACAAATCATCAGTGGCGGGATCAGAGGAGGCAGAGCCACCCACACCTCCTATTAAGCCAGTAACAAGGCAGAAGACAGTCCATGAGGCCCCACCCAGAAAGGGCCGGCGCTCTCGACGCTGCGGGCAGTGTCCAGGCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42541
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Nonsense 1664 4219 10 35
Genomic Location (Zv9):
Chromosome 15 (position 22753340)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23464527
GRCz11 15 23399792
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCCTTCCATCTCTTCTGCTTGGGGGAGGCAGAGCGGCCTCATGACGAA[C/T]AGTGGGAAAACTGGTGTTGCCGCCGATGCCGCTTTTGCCATGTTTGTGGG
Long Flanking Sequence:
CCCGATGGATGCACATGCTGATCAAATGTACCTTGAATACATTGCCAGTCACTTTGGATAAAAGCATCTTCGATATGCTTCTGTGTAATGTAAATATGATTGTTTACAGGAGAAACAGCTACCCAAACCTGACAGCAGTACTTTAAACTCCCAGAGCACTCCTTCGACTGGGGGCACAGCCAAGCAGAAAGCGCCCTACGATGGAGTGCATCGAATCAGAGTGGATTTCAAGGAGGACTATAACATTGAGAATGTGTGGGAGATGGGTGGGCTCAGCATTCTCACCTCTGTGCCAATCACCCCACGGGTGGTGTGCTTTCTTTGTGCCAGCAGCGGTAATGTAGAGGTGGGTCATCTTTTGTTAAAGGAGAAGAATCGAAGGCATAAAAAGGATGGGATGTGTTCTTATGCCTTGTTGTGTTTAGTTTGTTTTCTGCCAGGTGTGCTGTGAACCCTTCCATCTCTTCTGCTTGGGGGAGGCAGAGCGGCCTCATGACGAA[C/T]AGTGGGAAAACTGGTGTTGCCGCCGATGCCGCTTTTGCCATGTTTGTGGGCGGAAATATCAGAAAACCAAAGTAAGACATTTTATGAAGAATTCTGATGTAAAAGACTGCAAGAGCCATCTAAAAGTTTCCTCTAAAATGTACATCTTTCTCAGGCTCCTTTGTGTAGGTACAGTAATTTTACTTTTATGCCGAGTTTAGACTACATGATTTTAGCCCCAATTTTGACTCGCCGCTTTGAGAGATCAGCAACAAATTCTTGAAATCACAGGCAAATCGTTGCTCGTTCACGCGAGTAACAATCACACTCTGCGAACTATCAAAGTCGCGTTCTGAGAGAATCACAGTCGCCAATACCCATGAGATATTTTGCGTGCTGTTGGCGTCCTGTCGACGATTCAAAATCATGCGGTGTGAAATGTGTTCTGATTGTTAATAGCATCAGTGATCACCTATAACCAATGAGAGAGAAGCATCCACTAGTATGGGTATTGGCAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa137
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Nonsense 1668 4219 10 35
Genomic Location (Zv9):
Chromosome 15 (position 22753326)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23464513
GRCz11 15 23399778
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTGCTTGGGGGAGGCAGAGCGGCCTCATGACGAACAGTGGGAAAACTG[G/A]TGTTGCCGCCGATGCCGCTTTTGCCATGTTTGTGGGCGGAAATATCAGAA
Long Flanking Sequence:
ATGCTGATCAAATGTACCTTGAATACATTGCCAGTCACTTTGGATAAAAGCATCTTCGATATGCTTCTGTGTAATGTAAATATGATTGTTTACAGGAGAAACAGCTACCCAAACCTGACAGCAGTACTTTAAACTCCCAGAGCACTCCTTCGACTGGGGGCACAGCCAAGCAGAAAGCGCCCTACGATGGAGTGCATCGAATCAGAGTGGATTTCAAGGAGGACTATAACATTGAGAATGTGTGGGAGATGGGTGGGCTCAGCATTCTCACCTCTGTGCCAATCACCCCACGGGTGGTGTGCTTTCTTTGTGCCAGCAGCGGTAATGTAGAGGTGGGTCATCTTTTGTTAAAGGAGAAGAATCGAAGGCATAAAAAGGATGGGATGTGTTCTTATGCCTTGTTGTGTTTAGTTTGTTTTCTGCCAGGTGTGCTGTGAACCCTTCCATCTCTTCTGCTTGGGGGAGGCAGAGCGGCCTCATGACGAACAGTGGGAAAACTG[G/A]TGTTGCCGCCGATGCCGCTTTTGCCATGTTTGTGGGCGGAAATATCAGAAAACCAAAGTAAGACATTTTATGAAGAATTCTGATGTAAAAGACTGCAAGAGCCATCTAAAAGTTTCCTCTAAAATGTACATCTTTCTCAGGCTCCTTTGTGTAGGTACAGTAATTTTACTTTTATGCCGAGTTTAGACTACATGATTTTAGCCCCAATTTTGACTCGCCGCTTTGAGAGATCAGCAACAAATTCTTGAAATCACAGGCAAATCGTTGCTCGTTCACGCGAGTAACAATCACACTCTGCGAACTATCAAAGTCGCGTTCTGAGAGAATCACAGTCGCCAATACCCATGAGATATTTTGCGTGCTGTTGGCGTCCTGTCGACGATTCAAAATCATGCGGTGTGAAATGTGTTCTGATTGTTAATAGCATCAGTGATCACCTATAACCAATGAGAGAGAAGCATCCACTAGTATGGGTATTGGCAAGCCAGCGGGAAGTTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24984
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Nonsense 1762 4219 13 35
Genomic Location (Zv9):
Chromosome 15 (position 22751237)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23462424
GRCz11 15 23397689
KASP Assay ID:
554-7410.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTGTCATTAAACAATGTAATAAATGTTATTTCCCCCTTCCAGGCAACT[T/A]GTGCCCACTTTGTAATAAGGGCTATGATGACGATGACTGTGACAGCAAAA
Long Flanking Sequence:
TAAGCAACTTCCAAGTTTTAGCTTCTTTCTTTCTTTCTTAAAGCCCTTCAGAAATGACAAATGCTCAGTACTAAGATGGAAACAAACTTTTAAATGTTATTTTTTCCATCATCATTTAGCAGCTACTGGAGTGTGACAAGTGCCGAAACAGCTATCACCCCGAGTGCCTGGGACCCAACCATCCTACCAGACCCACCAAGAAGAAGAGAGTCTGGGTACTTGAATGCTCTAAATCTTAGAAGTCTGTAACATCTGTGGCAGCGTTCTCCCATAGTTATTTTTTCTTCTGCCACAGGTTTGCACCAAGTGTGTGCGCTGTAAGAGTTGTGGAGCCACCAAACCAGGAAAGGCCTGGGATGCCCAGTGGTCACATGATTTCTCTTTGTGTCATGACTGTGCCAAACGTTTAACTAAAGGTTAGTTCTAATCATCTTGAATGTTTATTGTATGCCTTGTCATTAAACAATGTAATAAATGTTATTTCCCCCTTCCAGGCAACT[T/A]GTGCCCACTTTGTAATAAGGGCTATGATGACGATGACTGTGACAGCAAAATGATGAAGTGCAAAAAGTGTGACCGCTGGGTCCATGCCAAATGTGAAAGCTTAACAGGTGAATTATCAAATTTTATTTGCATCTCTTATGTATCAAGTGGCATAACAAGGCACAATTTCATTTATTTTTTATTTGTTTATTTGGATTACAGAAATTTTATATTTTATTCTGTGAAGCAGCATAAATTTGAAAACTTACAAAGGGATTTATGATTTTGCCTAGTGTTTCTTTTTTAAATAAATCCTATTCTTTTAAAATTTAAAAAGATAAATGATTCTTCAGGCTCAAAATTTAGCAAATTAGAATCATTTCTAAAAGATCACATGCTAAGTTATTATAGTTAACGAAAACTAGAATTGAAAAACGTTTTGTTAACTGAAATAAAAATAAAAACGAGAGTTAAAAAAACAAACAAACTAGAACTAACTAAAACTGGATTGTGTATGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35881
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Essential Splice Site 1954 4219 16 35
Genomic Location (Zv9):
Chromosome 15 (position 22748257)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23459444
GRCz11 15 23394709
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTAGAGAGCAGGAAAGCCAACAGCATGCTCAAGTCCTTTTTTATTCGG[G/A]TGAGAAAAAGCTGGTGGACACACAGTTCTGACAGTTGGGTGTCTCGAAGT
Long Flanking Sequence:
TCTCAGTTGCCCACAGCTTTATTTCCACTATATACCTTAACATTGCCAATTGTTTCAGGCTGTTATGAAGCCACCTGAGCTCAACCCAGAGACCGAAGAAAGCCTTCCCTCACGACGTTCCCCAGAGGGTCCTGATCCCCCTGTGTTAACGGAGGTCTCTCCACCAAACGATTCGCCGCTCGATTTAGAGTCTGTGGAGAAGAAAATGGATTCTGGATGCTATAAATCTGTGGTAAGTTTTTCTCCTTTGTGAAATCCGAAAGGTAGCTTTTATGTTTTTATTCTTCTGCGAAAGATTATCTGTTGTCTTTTAAGCCTCCAGTTCAGCAGGGTTCAGGCAACGGTCACATGTGAGAGCCCAGGTGTCATTTTCTGTTCCTCTCTTTCAGCTGGAGTTCAGTGATGACATTGTGAAAATCATCCAGACAGCCTTCAACTCAGATGGAGGTCAGCTAGAGAGCAGGAAAGCCAACAGCATGCTCAAGTCCTTTTTTATTCGG[G/A]TGAGAAAAAGCTGGTGGACACACAGTTCTGACAGTTGGGTGTCTCGAAGTCCTGCGTTGTGTCTAATGACACTTGTCGCTTTTTTTTGTTACAGCAAATGGAGCGGATTTTTCCATGGTACAAGGTGAAGGAGTCCAAATTTTGGGAGACAAGCAAAGCTTCTTCCAAGTGAGTGCAAACTTTGTTTTAGTTTGCTTGCTGTTTTAATTTCAGCCTTAAAATTGATTTGATCAAAGAAGAATTTTTTCATTGCTAAGTTCCCACACAAAATATACGTTGTTTAAAGGTAAACAGTTGGACAAGTCAAGGTAGTGTTTGAGCATCGAGAGCAAACTCACCGCGGACTGTCTGTCTATTCTTTGCTCTCTGGTAGAGCAGAAATATCACCTTTCCATAGGGAATGCAGCCTGTATGGTCTAGTTCCATTGTTTGAGGTCGACAGGCAGTGTCACATTTCACATGGGGTGCTTTGACAAGTCTTGTGGTTGGCATTTGGTTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19112
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Essential Splice Site 2179 4219 21 35
ENSDART00000104525 Essential Splice Site 2179 4219 21 35
Genomic Location (Zv9):
Chromosome 15 (position 22744352)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23455539
GRCz11 15 23390804
KASP Assay ID:
2260-8462.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACAAGAAGGTTTACTGTCAGCATCACAAAGATCTTGTAAAGGGCGAGG[T/C]AAGGAGTGATGCATGCATATATCAGTAAGCAAGTTGTGCACTAAGGATTA
Long Flanking Sequence:
TACACTTGGATTTATAATTATGCTGGATTTCAGTTTTATAAGACATTGCTTGGTAATGTGTTTTTTAGGATTGTGGCAGACTGCTGTATATTGGTCATAATGAGTGGGCGCATGTGAACTGTGCCCTGTGGTCAGCAGAGGTGTATGAGGATGTTGATGGAGCTCTGAAAAATGTTCATATGGCTGTAAGCCGAGGCAAACAGCTGGTACGCACTGTGTCATGTTTGTTCATCGCAATAATATACATTAATCTGCTTAATTTTGGTATTTTATAAGTAGACCACTGTCAATAAATCTTTCCTTGCCCACAAACAGACTGCATAATGCTTTGTTTTCTCAGCAATGTAAGAATTGTCACAAACCTGGAGCCACTGTGAGTTGTTGTATGACCTCCTGCACCAACAACTACCATTTCATGTGTGCACGTCAGCAGCAGTGTGCCTTTTTAGAGGACAAGAAGGTTTACTGTCAGCATCACAAAGATCTTGTAAAGGGCGAGG[T/C]AAGGAGTGATGCATGCATATATCAGTAAGCAAGTTGTGCACTAAGGATTACTTATTTGTTGTGAATTATATATAATATATATATTTATATTTATTTATTTATTTATTTTTATTTTTTTTAAGGTGGTGCCAGAGTCTAGTTTTGAAGTAACTCGGAGGGTTCTTGTGGACTTTGAGGGAATCCGTCTGAGAAGAAAATTTGTTAATGGACTTGAACCAGATAACATACACATGGTGATAGGTCTGTATGTTGTTACAGGGGGCTTGTCTATGATAAAGAAATCACACTGCAGAAAAGTTAAATGTCCTTTTTTTTTTTATACAGGATCTATGACCATCGACTGTCTAGGTATGCTAACTGAACTGTCAGACTGTGAGAGGAAGCTATTTCCTGTGGGATACCAGTAAGTCTTTGAAAATTGTGTTGTTGCATTTTAATAAATACAAATAGAAATTAAATTAATTGATCAAATTATGCATTTACACAGATGTTCAAGGGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4605
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Essential Splice Site 2179 4219 21 35
ENSDART00000104525 Essential Splice Site 2179 4219 21 35
Genomic Location (Zv9):
Chromosome 15 (position 22744352)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23455539
GRCz11 15 23390804
KASP Assay ID:
2260-8462.1 (used for ordering genotyping assays)
KASP Sequence:
GGACAAGAAGGTTTACTGTCAGCATCACAAAGATCTTGTAAAGGGCGAGG[T/C]AAGGAGTGATGCATGCATATATCWGTAAGCAAGTTGTGCACTAAGGATTA
Long Flanking Sequence:
TACACTTGGATTTATAATTATGCTGGATTTCAGTTTTATAAGACATTGCTTGGTAATGTGTTTTTTAGGATTGTGGCAGACTGCTGTATATTGGTCATAATGAGTGGGCGCATGTGAACTGTGCCCTGTGGTCAGCAGAGGTGTATGAGGATGTTGATGGAGCTCTGAAAAATGTTCATATGGCTGTAAGCCGAGGCAAACAGCTGGTACGCACTGTGTCATGTTTGTTCATCGCAATAATATACATTAATCTGCTTAATTTTGGTATTTTATAAGTAGACCACTGTCAATAAATCTTTCCTTGCCCACAAACAGACTGCATAATGCTTTGTTTTCTCAGCAATGTAAGAATTGTCACAAACCTGGAGCCACTGTGAGTTGTTGTATGACCTCCTGCACCAACAACTACCATTTCATGTGTGCACGTCAGCAGCAGTGTGCCTTTTTAGAGGACAAGAAGGTTTACTGTCAGCATCACAAAGATCTTGTAAAGGGCGAGG[T/C]AAGGAGTGATGCATGCATATATCAGTAAGCAAGTTGTGCACTAAGGATTACTTATTTGTTGTGAATTATATATAATATATATATTTATATTTATTTATTTATTTATTTTTATTTTTTTTAAGGTGGTGCCAGAGTCTAGTTTTGAAGTAACTCGGAGGGTTCTTGTGGACTTTGAGGGAATCCGTCTGAGAAGAAAATTTGTTAATGGACTTGAACCAGATAACATACACATGGTGATAGGTCTGTATGTTGTTACAGGGGGCTTGTCTATGATAAAGAAATCACACTGCAGAAAAGTTAAATGTCCTTTTTTTTTTTATACAGGATCTATGACCATCGACTGTCTAGGTATGCTAACTGAACTGTCAGACTGTGAGAGGAAGCTATTTCCTGTGGGATACCAGTAAGTCTTTGAAAATTGTGTTGTTGCATTTTAATAAATACAAATAGAAATTAAATTAATTGATCAAATTATGCATTTACACAGATGTTCAAGGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10905
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Nonsense 2976 4219 26 35
ENSDART00000104525 Nonsense 2976 4219 26 35
Genomic Location (Zv9):
Chromosome 15 (position 22741496)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23452683
GRCz11 15 23387948
KASP Assay ID:
2260-8460.1 (used for ordering genotyping assays)
KASP Sequence:
CTGGYCTTCCATCTATTGCTGGTATTGATCAGTGTTTGGGAAGAGRTTCA[C/T]AGAWCCACAGATTCTTGAGGGACCAGGCAAAGGAGCATGAAGATGACAGT
Long Flanking Sequence:
CTGAATCAGACAGCCACATCCACCCGGATGATTCTGAAGAGCATCTCATGGACCACCAGTGTGCTGATGATGGGGAGGACAATAATTTAGAGGATGAAGGCAGTGTCGATAAACACCACGAGGAGGATAGTGATGGTTCAGCAGGTTCAGCAAAACGCAGATACCCAAGGAGGAGTGCCCGTGCTCGATCTAACATGTTTTTTGGGTTAACTCCATTCTATGGTGTTCGATCGTATGGTGAGGAAGACATACCCTTTTACAGAAGTGGTGAAATCTCTATGAAGAAGCGGACTGGGAGCAGCAAGCGCTCAGCCGAAGGGCAGGTTGATGGAGCAGATGATATGAGCACATCTTCTTCAGCAGACAGCGGAGAGGATGAAGAAGGAGGAATTGGCTCCAATAAGGATACTTACTATTACAACTTCACACGCACTATAATAAACCCTAGCTCTGGTCTTCCATCTATTGCTGGTATTGATCAGTGTTTGGGAAGAGGTTCA[C/T]AGATCCACAGATTCTTGAGGGACCAGGCAAAGGAGCATGAAGATGACAGTGATGAAGTTTCAACAGCAACCAAAAACTTGGAGCTGCAACAAATTGGTCAGCTGGATGGTGTAGATGATGGTTCAGAGAGTGACATTAGTATAAGTACCAGTAGCACAACCACTGCTACTACTTCATCCACACAAAAAGGTTCAACAAAAAGGAAAGGTAGAGAAAGTAGGACTGAAAAATCAAATGTTGACTCAGGGAAGGAGGCAGTAAATACCACTAGTAACAGCCGTGACAGTCGAAAAAATCAAAAGGATAACTGTCTTCCATTAGGAAGTGTGAAAACACAAGGACAAGACCCACTTGAAACTCAATTATCACTCACCACAGATCTGCTCAAGTCTGACTCTGATAACAACAACAGTGATGACTGTGGTAACATCTTACCCTCTGATATTATGGAGTTTGTGCTCAATACCCCTTCAATGCAGGCTTTGGGACAGCAAGCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19111
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Nonsense 2976 4219 26 35
ENSDART00000104525 Nonsense 2976 4219 26 35
Genomic Location (Zv9):
Chromosome 15 (position 22741496)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23452683
GRCz11 15 23387948
KASP Assay ID:
2260-8460.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGTCTTCCATCTATTGCTGGTATTGATCAGTGTTTGGGAAGAGGTTCA[C/T]AGATCCACAGATTCTTGAGGGACCAGGCAAAGGAGCATGAAGATGACAGT
Long Flanking Sequence:
CTGAATCAGACAGCCACATCCACCCGGATGATTCTGAAGAGCATCTCATGGACCACCAGTGTGCTGATGATGGGGAGGACAATAATTTAGAGGATGAAGGCAGTGTCGATAAACACCACGAGGAGGATAGTGATGGTTCAGCAGGTTCAGCAAAACGCAGATACCCAAGGAGGAGTGCCCGTGCTCGATCTAACATGTTTTTTGGGTTAACTCCATTCTATGGTGTTCGATCGTATGGTGAGGAAGACATACCCTTTTACAGAAGTGGTGAAATCTCTATGAAGAAGCGGACTGGGAGCAGCAAGCGCTCAGCCGAAGGGCAGGTTGATGGAGCAGATGATATGAGCACATCTTCTTCAGCAGACAGCGGAGAGGATGAAGAAGGAGGAATTGGCTCCAATAAGGATACTTACTATTACAACTTCACACGCACTATAATAAACCCTAGCTCTGGTCTTCCATCTATTGCTGGTATTGATCAGTGTTTGGGAAGAGGTTCA[C/T]AGATCCACAGATTCTTGAGGGACCAGGCAAAGGAGCATGAAGATGACAGTGATGAAGTTTCAACAGCAACCAAAAACTTGGAGCTGCAACAAATTGGTCAGCTGGATGGTGTAGATGATGGTTCAGAGAGTGACATTAGTATAAGTACCAGTAGCACAACCACTGCTACTACTTCATCCACACAAAAAGGTTCAACAAAAAGGAAAGGTAGAGAAAGTAGGACTGAAAAATCAAATGTTGACTCAGGGAAGGAGGCAGTAAATACCACTAGTAACAGCCGTGACAGTCGAAAAAATCAAAAGGATAACTGTCTTCCATTAGGAAGTGTGAAAACACAAGGACAAGACCCACTTGAAACTCAATTATCACTCACCACAGATCTGCTCAAGTCTGACTCTGATAACAACAACAGTGATGACTGTGGTAACATCTTACCCTCTGATATTATGGAGTTTGTGCTCAATACCCCTTCAATGCAGGCTTTGGGACAGCAAGCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22638
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Nonsense 3090 4219 26 35
Genomic Location (Zv9):
Chromosome 15 (position 22741154)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23452341
GRCz11 15 23387606
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAATCAAAAGGATAACTGTCTTCCATTAGGAAGTGTGAAAACACAAGGA[C/T]AAGACCCACTTGAAACTCAATTATCACTCACCACAGATCTGCTCAAGTCT
Long Flanking Sequence:
TGAGCACATCTTCTTCAGCAGACAGCGGAGAGGATGAAGAAGGAGGAATTGGCTCCAATAAGGATACTTACTATTACAACTTCACACGCACTATAATAAACCCTAGCTCTGGTCTTCCATCTATTGCTGGTATTGATCAGTGTTTGGGAAGAGGTTCACAGATCCACAGATTCTTGAGGGACCAGGCAAAGGAGCATGAAGATGACAGTGATGAAGTTTCAACAGCAACCAAAAACTTGGAGCTGCAACAAATTGGTCAGCTGGATGGTGTAGATGATGGTTCAGAGAGTGACATTAGTATAAGTACCAGTAGCACAACCACTGCTACTACTTCATCCACACAAAAAGGTTCAACAAAAAGGAAAGGTAGAGAAAGTAGGACTGAAAAATCAAATGTTGACTCAGGGAAGGAGGCAGTAAATACCACTAGTAACAGCCGTGACAGTCGAAAAAATCAAAAGGATAACTGTCTTCCATTAGGAAGTGTGAAAACACAAGGA[C/T]AAGACCCACTTGAAACTCAATTATCACTCACCACAGATCTGCTCAAGTCTGACTCTGATAACAACAACAGTGATGACTGTGGTAACATCTTACCCTCTGATATTATGGAGTTTGTGCTCAATACCCCTTCAATGCAGGCTTTGGGACAGCAAGCAGAAGCTCCTTCTGCTGAACAATTCTCTTTAGATGAGAGTTATGGGGTGGATGTTAACCAAAGAAAAGACATGCTTTTTGAAGATTTTACTCAGCCTCTGGCCAATGCTGAATCTGGCGAATCTGGGGTGAGCACTACCATTGCTGTAGAAGAGTCATACGGGCTTCCTCTTGAGCTGCCCTCTGACCTCTCTGTGCTTACAACTCGAAGTCCCACTGTAAGTAATCAAAATCATGGGCCACTTATCTCGGAAACCTCTGAACGCACCATGTTAGCTCTGGCTACGGAAGAGTCAGAAGCTGGGAAAAGCAAGAAGAAAACAAGAACGGGGTCCACTGTATCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2815
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104525 Nonsense 4194 4219 35 35
Genomic Location (Zv9):
Chromosome 15 (position 22737015)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23448202
GRCz11 15 23383467
KASP Assay ID:
554-3171.1 (used for ordering genotyping assays)
KASP Sequence:
ATTTTTGCCACACGCAAGATCTATAAAGGCGAGGAGCTCACGTATGATTA[C/A]AAGTTTCCCATCGAAGAACCAGGCAATAAGCTGCCTTGCAACTGCGGGGC
Long Flanking Sequence:
CTTTTTAAAATGAAAAAGAAAGGTTGGATAGAGGACAGAAAACAAATATGCTGCTTCATTGCATTCAAACTTATGTTTATTCACAGATCAGCCATACATGGCAGAGGTTTGTTCTGCAGGAAGAACATTGAGCCCGGAGAAATGGTGATCGAGTATTCTGGCAATGTAATTCGTTCTGTCCTCACTGACAAGCGGGAGAAGTACTATGATGACAAGGTAGAATTCTTGATGGTTCATGAATGCAGTTTGAAATCATTATCAGTGTTACTTAACGATTTAATATTTATTTTCTTTAATACTCAGGGCATTGGCTGCTACATGTTTCGAATCGATGACTACGAGGTGGTGGATGCTACCATTCACGGCAACTCAGCCCGTTTCATTAACCACTCATGCGAGCCCAACTGCTACTCTCGTGTGGTCAATGTTGACGGTCAGAAGCACATTGTCATTTTTGCCACACGCAAGATCTATAAAGGCGAGGAGCTCACGTATGATTA[C/A]AAGTTTCCCATCGAAGAACCAGGCAATAAGCTGCCTTGCAACTGCGGGGCAAAGAAGTGTCGCAAGTTCCTCAATTGAAAGCAAATTCACAATGTAAAAGTATCTGTGAAGCGCTATCAAGAGTGTACACTTGCCAGGGAAGAGACATTTTTAAATGTTTTGTTTTTTACCGAAGCAGGCTCAGGTTATCAGAAGGTTAATGGTATTGTGCCTCTTAAGTTGTTTGGTTTTTAGAAAAAGACATTCGAGCGGAGTCACAATGGAGAAGATTGCCCTTATGTCCCTTTTAGTAATGTGCAATTTAAGAGATTAGTGCCCCTTCATTCTTAACGTTTTGTATGTGCTCTTTTATTTGACCATTTTGTTTTTATAAGAAGGATATTGTGAATAGTTTTAAATTTGTAATAAGTCGAGTCTGGCCTGCCCTTACTTACTGAGTGTGACAAATTACTGAAAAATTGCCACATCGTTCCATTCTACACCAAAGTGCAATTTCGGAA
Associated Phenotype:
Not determined