Busch Lab

ZMP

tnfrsfa

Ensembl ID:
ENSDARG00000004451
ZFIN ID:
ZDB-GENE-010802-1
Description:
tumor necrosis factor receptor superfamily, member a [Source:RefSeq peptide;Acc:NP_571915]
Human Orthologues:
TNFRSF10A, TNFRSF10B, TNFRSF10C, TNFRSF10D
Human Descriptions:
tumor necrosis factor receptor superfamily, member 10a [Source:HGNC Symbol;Acc:11904]
tumor necrosis factor receptor superfamily, member 10b [Source:HGNC Symbol;Acc:11905]
tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain [Sourc
tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain [Source:HG
Mouse Orthologue:
Tnfrsf10b
Mouse Description:
tumor necrosis factor receptor superfamily, member 10b Gene [Source:MGI Symbol;Acc:MGI:1341090]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa7247 Missense, Nonsense Mutation detected in F1 DNA Not yet available
sa37265 Missense, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7247
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101920 Nonsense 315 435 10 12
ENSDART00000124871 Missense 317 436 8 10
Genomic Location (Zv9):
Chromosome 21 (position 14378525)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 16079480
GRCz11 21 16175457
KASP Assay ID:
554-4913.1 (used for ordering genotyping assays)
KASP Sequence:
CCCTCAAATCATTGGGGATTCACCGCGATCCAGCCCCCCGGCCCAGAGAC[C/T]GACYGACAGAGATCAGACTGAATCATGGCCACGGGTTAGTGAGAWKAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37265
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101920 Missense 324 435 10 12
ENSDART00000124871 Nonsense 326 436 8 10
Genomic Location (Zv9):
Chromosome 21 (position 14378497)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 16079452
GRCz11 21 16175429
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCAGCCCCCCGGCCCAGAGACCGACCGACAGAGATCAGACTGAATCATG[G/A]CCACGGGTTAGTGAGAATAACATCTACCCCACAGTTTTCACACTGCACAA
Associated Phenotype:
Not determined