Busch Lab

ZMP

LOC568406

Ensembl ID:
ENSDARG00000004445
Human Orthologue:
GRM5
Human Description:
glutamate receptor, metabotropic 5 [Source:HGNC Symbol;Acc:4597]
Mouse Orthologue:
Grm5
Mouse Description:
glutamate receptor, metabotropic 5 Gene [Source:MGI Symbol;Acc:MGI:1351342]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa17188 Nonsense Available for shipment Available now
sa9121 Nonsense Mutation detected in F1 DNA Not yet available
sa27613 Nonsense Mutation detected in F1 DNA Not yet available
sa24870 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17188
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042767 Nonsense 183 1177 1 8
Genomic Location (Zv9):
Chromosome 10 (position 25848381)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25252339
GRCz11 10 25222920
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAGGTGCAGAATCTMCTGCAGCTCTTCAATATTCCCCAGATCGCGTATT[C/A]GGCAACCAGCATGGATCTCAGCGATAAGTCTTTGTATAAGTACTTCMTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9121
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042767 Nonsense 483 1177 5 8
Genomic Location (Zv9):
Chromosome 10 (position 25878572)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25282530
GRCz11 10 25252867
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGACGGTGCTTCTACKTGTTTTTCCAGGTATGAAATCAKGAACTTTAAA[C/T]AGAKGAGTGAAGAGGACTACAGCTACAWCCAYGTGGGCAGCTGGGACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27613
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042767 Nonsense 656 1177 7 8
Genomic Location (Zv9):
Chromosome 10 (position 25887405)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25291363
GRCz11 10 25261651
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTGTACCTTCTGCCTCATTGCCAAGCCACACGTTGCCTACTGTTACT[T/A]GCAGAGGCTGGGCATCGGGCTCTCGCCGGCCATGAGCTACTCGGCACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24870
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042767 Nonsense 1000 1177 8 8
Genomic Location (Zv9):
Chromosome 10 (position 25893515)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25297473
GRCz11 10 25267731
KASP Assay ID:
554-7666.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGAACGTGCGCAAGTAGTAGCCATACCTTCATACCTAACCGAGCGTCTA[C/T]AACACCAACCATCCTCCATCATGGATCAAATCAGCTGCGTGGTCAGTCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2552
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042767 Nonsense 1060 1177 8 8
Genomic Location (Zv9):
Chromosome 10 (position 25893695)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25297653
GRCz11 10 25267911
KASP Assay ID:
554-2972.1 (used for ordering genotyping assays)
KASP Sequence:
CCTCCGCCAACCCCCCAAGACCCTGTTCACCATCCTACCGTCACCACCAG[C/T]AGGAAAGACCACATCCTACCACCGTCACTACATACGCAGAYGTTGTGGCC
Associated Phenotype:
Not determined