Busch Lab

ZMP

vangl1

Ensembl ID:
ENSDARG00000004305
ZFIN ID:
ZDB-GENE-040621-2
Description:
vang-like protein 1 [Source:RefSeq peptide;Acc:NP_991313]
Human Orthologue:
VANGL1
Human Description:
vang-like 1 (van gogh, Drosophila) [Source:HGNC Symbol;Acc:15512]
Mouse Orthologue:
Vangl1
Mouse Description:
vang-like 1 (van gogh, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2159344]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa15707 Nonsense Available for shipment Available now
sa13010 Nonsense Available for shipment Available now
sa16745 Essential Splice Site Available for shipment Available now
sa34683 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41461 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15707
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036926 Nonsense 73 527 3 8
Genomic Location (Zv9):
Chromosome 9 (position 34075491)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33231437
GRCz11 9 33042183
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTTTATGCGTGTGATCTWAGCGACTGATCTCTCGACAGGATGAYAACT[G/A]GGGTGAAACCACCACGGCGGTCACTGGAACATCAGACCACAGCTTGTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13010
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036926 Nonsense 140 527 3 8
Genomic Location (Zv9):
Chromosome 9 (position 34075692)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33231638
GRCz11 9 33042384
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGGTCCTGGTCACCCCTYTGTCCTTCCTGRTTTTGCCACAGTTAATGT[G/A]GCCGGAGCGCCTGCAGACTTGCGGTACTGCATGTGAAGGCCTGTTYCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16745
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036926 Essential Splice Site 214 527 3 8
Genomic Location (Zv9):
Chromosome 9 (position 34075917)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33231863
GRCz11 9 33042609
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGYTGTCCTATTGGCTRTTTTTTGGAGYGCGCATATTGGACTCACAGG[T/C]AAGGGCACATGTCTGAAAATNAAAAAAGTGGCAAGAGAAACATGTTYTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34683
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036926 Essential Splice Site 273 527 4 8
Genomic Location (Zv9):
Chromosome 9 (position 34077355)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33233301
GRCz11 9 33044047
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCGCTCCACTGATGGAGAAACTCACCACTATAACATGGGACAACTCAGG[T/C]ACCAGCTGATATTTATAAACAAACACTAATGCAAGAGTTCACACTTAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41461
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036926 Nonsense 348 527 6 8
Genomic Location (Zv9):
Chromosome 9 (position 34086196)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33242142
GRCz11 9 33052888
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGCAGCTGCCGCACGACAGAGAGACACCAGTCATAATGAGCTGTACTA[C/A]GAGGAAGCAGAGCATGATAGACGAGTCCGTAAGCGCAAAGCACGGTAAGA
Associated Phenotype:
Not determined