Busch Lab

ZMP

zgc:109986

Ensembl ID:
ENSDARG00000004265
ZFIN ID:
ZDB-GENE-050522-136
Description:
hypothetical protein LOC553566 [Source:RefSeq peptide;Acc:NP_001018381]
Mouse Orthologue:
2700097O09Rik
Mouse Description:
RIKEN cDNA 2700097O09 gene Gene [Source:MGI Symbol;Acc:MGI:1919908]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa36340 Nonsense Mutation detected in F1 DNA Not yet available
sa42876 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4697
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025410 Essential Splice Site 120 306 None 8
ENSDART00000146172 Essential Splice Site 120 205 None 5

The following transcripts of ENSDARG00000004265 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 10532074)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9913250
GRCz11 17 10069284
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTCGCACCTACTGCCTCAACTGTGGATCACACAGAACCGCACCGTTGGG[T/C]GAGTGTTTGCATGAATACTATATGCTATGCAGGTAGTGCTGTGACTATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36340
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025410 Nonsense 151 306 4 8
ENSDART00000146172 Nonsense 151 205 4 5

The following transcripts of ENSDARG00000004265 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 10534804)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9910520
GRCz11 17 10066554
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTCCACAACGTTCTTCCAGAACTCACTGGAAAACTGGTGTTGGATGTG[G/T]GATCAAGACTAGGAGCTGTGCTGTTCGGGGTAAACTGCTGATGATTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42876
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025410 Essential Splice Site 266 306 7 8
ENSDART00000146172 None None 205 None 5

The following transcripts of ENSDARG00000004265 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 10537289)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9908035
GRCz11 17 10064069
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTGTACCCAGCATTCAGGAGGCACTTGGTTTACTTCAGGATGCTGCTG[T/A]GAGTAACTTTATATCTGATATTACAGAATAAGGGTTCGTCTCACTCAGCT
Associated Phenotype:
Not determined