Busch Lab

ZMP

slit2

Ensembl ID:
ENSDARG00000004246
ZFIN ID:
ZDB-GENE-010306-3
Description:
slit homolog 2 protein [Source:RefSeq peptide;Acc:NP_571810]
Human Orthologue:
SLIT2
Human Description:
slit homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:11086]
Mouse Orthologue:
Slit2
Mouse Description:
slit homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1315205]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa231 Nonsense Confirmed mutation in F2 line Not yet available
sa15818 Nonsense Available for shipment Available now
sa1772 Nonsense Available for shipment Available now
sa39610 Nonsense Mutation detected in F1 DNA Not yet available
sa12974 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25573
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007531 Essential Splice Site 320 1512 11 36
Genomic Location (Zv9):
Chromosome 1 (position 22632342)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23167509
GRCz11 1 23858248
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAATCACACACAAACACACGTATTCTCTAATTGTTCTTTTTTTTGTTTC[A/T]GAGATCTAAGTAATAATCAAATAACTGAATTGGCTTCAGACTCCTTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa231
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007531 Nonsense 378 1512 13 36
Genomic Location (Zv9):
Chromosome 1 (position 22636966)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23172133
GRCz11 1 23862872
KASP Assay ID:
554-0161.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCGAATGTTTATCCCAACAGATTGCTGAATGCGAACAAGATCAATTGTT[T/A]GCGTGTAGATTCTTTCCAAGACCTGCAGAATCTGAATCTTCTGTCGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15818
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007531 Nonsense 603 1512 18 36
Genomic Location (Zv9):
Chromosome 1 (position 22644693)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23179860
GRCz11 1 23870599
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGTCTCTGTTTGTCACATGTAGGATGTTGAGGAGTAACAGGATAAGCTG[T/A]GTCAATAACGGCAGTTTTACCGGTCTGAGCTCTGTGAGGTTGCTTTCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1772
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007531 Nonsense 716 1512 20 36
Genomic Location (Zv9):
Chromosome 1 (position 22648095)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23183262
GRCz11 1 23874001
KASP Assay ID:
554-1765.1 (used for ordering genotyping assays)
KASP Sequence:
GATGAGAATAGCTGTTCACCACTGGCTCGCTGTCCTGCCGAGTGTTCGTG[T/A]TTGGATACAGTGGTTCGTTGCAGTAATAAAGGACTCAAGGTTYTGCCTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18696
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007531 Nonsense 911 1512 26 36
ENSDART00000007531 Nonsense 911 1512 26 36
Genomic Location (Zv9):
Chromosome 1 (position 22653824)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23188991
GRCz11 1 23879730
KASP Assay ID:
2259-0571.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGATGTAAGCATTTTGGCTAAATGTAACCCTTGCTTGTCCAATCCCTGC[A/T]AGAATGATGGGACCTGCAGTAACCATCCTGTAGATTTTTACAGATGCACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7905
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007531 Nonsense 911 1512 26 36
ENSDART00000007531 Nonsense 911 1512 26 36
Genomic Location (Zv9):
Chromosome 1 (position 22653824)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23188991
GRCz11 1 23879730
KASP Assay ID:
2259-0571.1 (used for ordering genotyping assays)
KASP Sequence:
TGGATGTAAGCATTTTGGCTAAATGTAACCCTTGCTTGTCCAATCCCTGC[A/T]AGAATGATGGGACCTGCAGKAACCATCCTGTAGATTTTTACAGATGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39610
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007531 Nonsense 1320 1512 34 36
Genomic Location (Zv9):
Chromosome 1 (position 22677101)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23212268
GRCz11 1 23903007
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACCCAGTTTTTGCTGCAGGAGGGTGTTGTGCCCGGATGCCAGCCATGC[C/T]AGCGGAGCATGTGTGCTCATGGCCAGTGCCATGCCACTGGACAGTCCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12974
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007531 Nonsense 1462 1512 36 36
Genomic Location (Zv9):
Chromosome 1 (position 22682645)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23217812
GRCz11 1 23908551
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACGCAGCAGGGCTACGCCGCGTGCCAGAGCACAGAGAAGGTCTCGCGTT[T/A]AGAGTGTCGGGGCAGCTGTGGGGRYGGGACCTCCTGCTGCGCCCCGCTCC
Associated Phenotype:
Not determined