Busch Lab

ZMP

si:dkey-48h7.2

Ensembl ID:
ENSDARG00000004227
ZFIN ID:
ZDB-GENE-041210-23
Description:
Novel protein similar to vertebrate phosphodiesterase 3A, cGMP-inhibited (PDE3A) [Source:UniProtKB/T
Human Orthologue:
PDE3A
Human Description:
phosphodiesterase 3A, cGMP-inhibited [Source:HGNC Symbol;Acc:8778]
Mouse Orthologue:
Pde3a
Mouse Description:
phosphodiesterase 3A, cGMP inhibited Gene [Source:MGI Symbol;Acc:MGI:1860764]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5240
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026207 None None 155 None 3
ENSDART00000133843 Nonsense 759 1047 13 16
Genomic Location (Zv9):
Chromosome 4 (position 2632976)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2831855
GRCz11 4 2761966
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGCCAGTTTGGACCACATGGAGTTTAAACGCTTTCGCTTCCTGGTCATC[G/T]AAGCCATTCTGGCCACTGACCTCAAGAAACACTTTGATTTCCTGGCCGAA
Associated Phenotype:
Not determined