Busch Lab

ZMP

zgc:92630

Ensembl ID:
ENSDARG00000004141
ZFIN ID:
ZDB-GENE-040718-449
Description:
hypothetical protein LOC436969 [Source:RefSeq peptide;Acc:NP_001002696]
Human Orthologue:
DHRS11
Human Description:
dehydrogenase/reductase (SDR family) member 11 [Source:HGNC Symbol;Acc:28639]
Mouse Orthologue:
Dhrs11
Mouse Description:
dehydrogenase/reductase (SDR family) member 11 Gene [Source:MGI Symbol;Acc:MGI:2652816]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42507 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35828 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42507
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127436 Essential Splice Site 45 255 2 7
Genomic Location (Zv9):
Chromosome 15 (position 14449697)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15494660
GRCz11 15 15430682
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTGTTCCCTTCATGGAATGTAATTCTCAAAGATCTCTTTTCCTTTTGC[A/C]GAAACTGGCGGCTGAATGTGTCAGTAGCGGATACAGCGGTGCTCTGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35828
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127436 Nonsense 233 255 6 7
Genomic Location (Zv9):
Chromosome 15 (position 14450611)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15495574
GRCz11 15 15431596
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCATTTACAGTGCCTGCAAGCTGATGACATAACCAATGCAGTGGTGTA[T/A]GTTCTAAGTGCTCCTCCTCACGTCCAAGTAAGCAACGCCAATCACTTTTC
Associated Phenotype:
Not determined