Busch Lab

ZMP

rttn

Ensembl ID:
ENSDARG00000004131
ZFIN ID:
ZDB-GENE-090609-5
Human Orthologue:
RTTN
Human Description:
rotatin [Source:HGNC Symbol;Acc:18654]
Mouse Orthologue:
Rttn
Mouse Description:
rotatin Gene [Source:MGI Symbol;Acc:MGI:2179288]

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa44111 Nonsense Mutation detected in F1 DNA Not yet available
sa8719 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32481 Nonsense Available for shipment Available now
sa25211 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa801 Nonsense Available for shipment Available now
sa30066 Nonsense Mutation detected in F1 DNA Not yet available
sa44110 Nonsense Mutation detected in F1 DNA Not yet available
sa37847 Nonsense Mutation detected in F1 DNA Not yet available
sa44109 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44111
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006930 Nonsense 203 2234 6 49
ENSDART00000142473 None None 318 None 9
Genomic Location (Zv9):
Chromosome 24 (position 15156304)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 15107752
GRCz11 24 15252171
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCATTAGTTCCCTTAGAAGCGACAACCACAACTTAGTGCGAACCACCTG[T/A]GAGCTGCTTCGTGATGTCATCATGCAAGACTTCCCAGCTGAAATATTCCT
Long Flanking Sequence:
GTAAATCTATTCCTACAATGCTATAATAAATTTTGCCTGTTTCACAGTAGGCTCAAAAGTATCCCAAAGCACCTCAAAAAAAACTCAAAAAGGACCTAAATGTTCTTTTGAATCTTTTTGTAAGACGTTTGTAACAACATAAACCGATTATTGATTAGGTGTTCTGTCATCTAGCCCAAAAATCTTTCCAATAGGCCCCGAACCACCCTTATTGTTAAAATCTGACCTCCACACTACACAGGACTTTATTATACTTTATGTTCCTTTTTTGTTTCTTTACCCTGCAGTCAGTACTAGGTGCTTGAAGTTCTCTGTTTTTCCATGGCTGTCTTTGAACACAACAGATCGACATATATTGTCATCAAATGAAAGGTACCCTCTGTTTGCTGTTATTTTACCTCATTTACCCTCTAATTTACATCCTACTGACAAAATAACATCATTTACTCGATCATTAGTTCCCTTAGAAGCGACAACCACAACTTAGTGCGAACCACCTG[T/A]GAGCTGCTTCGTGATGTCATCATGCAAGACTTCCCAGCTGAAATATTCCTGCAAAGGCCAAGTACAGTTCAAGTAAGACTTGAATTTCATTTCTGTCTTCAATCTGTCTGTTGTTTTAACCCCTGATGAGAGATTCATAAGTTGAGTGACAGCGATGAAAGTGATATCGCGGGGCTCCATAATCCCCGTTTCGTTCTATAATTGAAATTCCACAGAATCTGATTGGCTGTCCAATGCCTTCAACTCCGGAAAGTATTGGAATGACAGCGACAAATCTTGTCTTATGTCTAGAACTGTACCGTGATGATTAGCTGGCAAGCTGACACATGCCGTTTTAGTACAAGCGTTTAAAACCAAGTGACAAGCATTGTTGTTTATCTGTCAAAAATGTGTTGGCGCAGATGCATTGGAGATTATCTGAGATATGCAGTCTCAGTGCTCTCAATGAAAATTATTTATCAGGCTGGGATAAAGTGGTTTGGAAGCGCTCTCTTCAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8719
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006930 Essential Splice Site 227 2234 6 49
ENSDART00000142473 None None 318 None 9
Genomic Location (Zv9):
Chromosome 24 (position 15156230)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 15107678
GRCz11 24 15252097
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAAGACTTCCCAGCTGAAATATTCCTGCAAAGGCCAAGTACAGTTCAAG[T/G]AAGACTTNNNNTTCATTTCTGTCTTCAATCTGTCTGTTGTTTTAACCCCT
Long Flanking Sequence:
CAAAAAAAACTCAAAAAGGACCTAAATGTTCTTTTGAATCTTTTTGTAAGACGTTTGTAACAACATAAACCGATTATTGATTAGGTGTTCTGTCATCTAGCCCAAAAATCTTTCCAATAGGCCCCGAACCACCCTTATTGTTAAAATCTGACCTCCACACTACACAGGACTTTATTATACTTTATGTTCCTTTTTTGTTTCTTTACCCTGCAGTCAGTACTAGGTGCTTGAAGTTCTCTGTTTTTCCATGGCTGTCTTTGAACACAACAGATCGACATATATTGTCATCAAATGAAAGGTACCCTCTGTTTGCTGTTATTTTACCTCATTTACCCTCTAATTTACATCCTACTGACAAAATAACATCATTTACTCGATCATTAGTTCCCTTAGAAGCGACAACCACAACTTAGTGCGAACCACCTGTGAGCTGCTTCGTGATGTCATCATGCAAGACTTCCCAGCTGAAATATTCCTGCAAAGGCCAAGTACAGTTCAAG[T/G]AAGACTTGAATTTCATTTCTGTCTTCAATCTGTCTGTTGTTTTAACCCCTGATGAGAGATTCATAAGTTGAGTGACAGCGATGAAAGTGATATCGCGGGGCTCCATAATCCCCGTTTCGTTCTATAATTGAAATTCCACAGAATCTGATTGGCTGTCCAATGCCTTCAACTCCGGAAAGTATTGGAATGACAGCGACAAATCTTGTCTTATGTCTAGAACTGTACCGTGATGATTAGCTGGCAAGCTGACACATGCCGTTTTAGTACAAGCGTTTAAAACCAAGTGACAAGCATTGTTGTTTATCTGTCAAAAATGTGTTGGCGCAGATGCATTGGAGATTATCTGAGATATGCAGTCTCAGTGCTCTCAATGAAAATTATTTATCAGGCTGGGATAAAGTGGTTTGGAAGCGCTCTCTTCAGCTAATGCTCTTGAACTTTTGTGTAATTGTTTAAAAATTGAATGTGCCAGCGATTCCGACTCGGAGTGATCAGTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32481
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006930 Nonsense 264 2234 7 49
ENSDART00000142473 None None 318 None 9
Genomic Location (Zv9):
Chromosome 24 (position 15155351)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 15106799
GRCz11 24 15251218
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGCATTGGCCTGTCTGCAACAGCTTTGCAGGAACTTGAAGAGCCGCCTA[C/T]GATTTTACAGAGATCCAAGCTTCTTCTCAGCCAAACAAGGTACCCCACAA
Long Flanking Sequence:
TATTTATCAGGCTGGGATAAAGTGGTTTGGAAGCGCTCTCTTCAGCTAATGCTCTTGAACTTTTGTGTAATTGTTTAAAAATTGAATGTGCCAGCGATTCCGACTCGGAGTGATCAGTTCAATTAGGTTTATTGAATCACTTTCATTCATTTGCATTGCTTTGGTACCACTGGAGGGGTAGTGCGTTTTAAATTGGTACAAATTACACAACTTAAAAGTCAGTATCAGGTGGCCTTTTATTTAGTGTCTAATTGAATGCAGAATCAGCTCTCCTGAAAGGCTTGCACCATTTAGATCAGTTGTTTTTGTTATAACAGGTCTGCACTTGTCCTCGTGGGTTTACAAGACAACATCAGCTTCTGTTTTCATGTATTGCTGTTTTCCCCCTCTAGAGTCTGCTGTCACTTCTCGGTCTGAATGTTGATGGTGATGTCAGCTACCTGACGTTCCAGGCATTGGCCTGTCTGCAACAGCTTTGCAGGAACTTGAAGAGCCGCCTA[C/T]GATTTTACAGAGATCCAAGCTTCTTCTCAGCCAAACAAGGTACCCCACAACATCTATTATGAATATGTAAACTTTTCCTAATGTGGGGGTTCGCTCCTAGCAGTTGAACTTTTTTATTCGAATTTTGCAGCACTCAAAAACTCAGATGCTCCATTTATACTTGGTATTAACTCTTTCCCAGTCATTGTTTTTTTTTTTTTTTTTTTTCAGTCACCAGCATTTTAAAGATTTTTACCTAAATTTGTTTATATATATATATATATATATATATATATATATATTAGGGATGGGAAGATTAACCGATATGTATCGATACGCGGTCATGCGCGTGCACGATGCGAGTGCATCGGTTGAGCAGCAGAGGATGAATGAAATTTTGGAAGCAAATCGAGATGCATCGGTTTTTGCGAGATGCATCGGTTTTTCCAAGATACAGCTTATATTTTTAATATAGAATGTATTTTTTATTTATTAACAAGTGTTGTCAACCTGTTTTGGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25211
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006930 Essential Splice Site 435 2234 11 49
ENSDART00000142473 None None 318 None 9
Genomic Location (Zv9):
Chromosome 24 (position 15135811)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 15087259
GRCz11 24 15231678
KASP Assay ID:
554-7645.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGACATGCTCTTACTAACATCAGTCTTTTTGTACATGTGTTTTTTTTAA[G/A]AGAGAGAAATTACAGGCATGTATAGAGATTTTGGGAGATGTTATTTGCTA
Long Flanking Sequence:
TCATAATGCATAAACTAATGTGAACACATGCCAGTAGCTACAATAAGTGCAGATATTTAGCCATGCTTCAGAAATGTTAACCATCTCAACCTAGAGTTTAATTGTGGTCATTATGCAAAGTTTACTTTGTTTCATTCAGCTTATGAGTGTTTTACATAAAATGGCATCAACGTATGATTGTATACCATGGATTATGTAGGTCGCACGGCACCAAATAGGCCTCGTCCAATGATGTTCATTGCCTCTAGAAATCTTTTTAAACGAACTCATTGTGTGTGCACCTATGAGAACATTCCCCAGCGCATATGATTATGTATATTTCACGGCGTGCCTCTCTCCCTCATTGATCTTTAATGCACGCTCATGGCGTTTTTATCTTGAAAAACTGCTGTCATCTGAAAACTTTCTTTGAAATGCACAGGACTCTTGCTGCCCCCTGCTGGCGGTAACATGACATGCTCTTACTAACATCAGTCTTTTTGTACATGTGTTTTTTTTAA[G/A]AGAGAGAAATTACAGGCATGTATAGAGATTTTGGGAGATGTTATTTGCTACCACCATGGCATGACTTCCTCAGAACATCCAGAATCGTCTCTGATCCACCACAGAATGGTCTTCACAGGCACTGCCGTTTTCACAATACGTCTCCTGCAAACCTTGTTACCTGTGGAGAAGGTGAGTGAGCATATGGCCGTGCCATTCTTAGACATTAATAAGCCGTGCCACCACTGTCGCTGAATGGACATATGGCCGTGTCCTTCATGGTCATTATTAAAACAAATGAGAGTGCGAAACACACCAGAAGTTCACAGTGAAAGGGTCAATTGTTCAGTTAAGCTCCAGACCTAAGGACAACACTATAATTGCAGACAAATCTATTAGCGTTTCATTTTTTGTGTGTGTTTTATTACCTTGTGTGTGTTGTCTTTACAAACAGGCTGCGGATAATCTTCCGGAAAGTACCGTGGCTGCCATTTTCCTGTTGTGTCTTGATATATCCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa801
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006930 Nonsense 1037 2234 24 49
ENSDART00000142473 None None 318 None 9

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 15109137)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 15060585
GRCz11 24 15205004
KASP Assay ID:
554-0706.1 (used for ordering genotyping assays)
KASP Sequence:
TGCAGATCACCTGGAACACAGCATGGCATTCTGGGATTGATGGATTGCTA[G/T]AGCACCTGAGGGGTTTTAGAAGTGATGTGCCAGAGTAAGTTGGATTCATC
Long Flanking Sequence:
ACACTAATGTCAAATCCACCAGAGTTACAGACCACTCCTTTCTTTCTTTCATTTTATTAATGGTAAACATGCTATCAGCAAGAACGCTTCGGCTCACGTTCATTTCATTATCTTTGTTCTCTCATCAGGACTGACGAAGCTGGCTCAGACACAGGCCTGTCTTCCTTCTCACTTCCTGCAGCCATTATACGGAGGTAAATTACATCCCTTTACAAGTGCATTAACGGCCATTTAATTTCTCCATAACCTGGCTTTCAGAGTTGTCATTGGTCATTAAAGCAAGGGTTTAACTATTATTTGACAGATTGATTGCAGAACTGTTATATCTGATCTTTTTTCACAGGTACAATTTGCCGTTTCAAGCTCCTTCACATCATGCAGTGAGTCCATACTGTTCAGTTCTTCCTCCATACTCAGATCTCCTGAGTCTGAAGCCCGCCTGGGAAGCTCTGCAGATCACCTGGAACACAGCATGGCATTCTGGGATTGATGGATTGCTA[G/T]AGCACCTGAGGGGTTTTAGAAGTGATGTGCCAGAGTAAGTTGGATTCATCCGTTTAGATGTTTGTAAAAGTTCATGTTGGAGAGGACTTTCAGGAAATTTAATTTAATTTGATTTGATGTGATTTGATTTGATTTGATTTGATTTGATTTGATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTGTTACATTTGGTTACATTCAGTTAAAGTCAGTTACATTCAGTTATATTCAATTATGTCCCGTTTCATCCAATTACATCCACTTACATTCAATTACACCCAATTACAGCCATATACATTTAGTTACATTCAAATACATTACATTCATGTACATTGTCACACCCAATTACATCCAGTTACATCCAATTAAAGCCACTCACATCCAGTTACATTCAATTACATTACATTTAGTTACATTCAATTACATCGTATTGACTTGCATT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30067
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006930 Nonsense 1156 2234 26 49
ENSDART00000142473 None None 318 None 9
Genomic Location (Zv9):
Chromosome 24 (position 15102091)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 15053539
GRCz11 24 15197958
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAGAGGCTCCTGGTGGACATTCTGTCCTTCCTCAACACGTTCTTCAAG[C/T]AGAATCAATCTGAACTGGACCAGCAGGACCTTAAATGGTTGTTGGAATTA
Long Flanking Sequence:
ACTGCTGTGTTTTTTATTCTAACTCCTGTGACTGGCATCTGTATTGACAGTCTTCATCTTCGGAGTAGAATTGCACCATGACACCTGTACTGCGACTGTTTGGGATGAATACATGTACCGTTACATCCATAATATTAATATTGTACATGCATACAGTATATATGCTTAGTTTAATATGTAATGCAATGTGCACATCTACTTGATATATACATTTACACTTTTATTTGTTTCTTATTTCACTTTTATCACAACAACCGTTTTATTTTAAGTGCTGTATGTAGAATGATTTTTTGATCCTTTTAACTTTGTAGGTTGACTTTGTTTGGTGACAAAAGTGCACTTTAATTTCTGACTCTGCTTTGAACTTCTTTTTTTTGTGTTTATATATGCATTTATTTATTGTTTAATTATCCCACAGATTTCTGGTTGTACGTCCAGCTTGCCATCAAGATGAGAGGCTCCTGGTGGACATTCTGTCCTTCCTCAACACGTTCTTCAAG[C/T]AGAATCAATCTGAACTGGACCAGCAGGACCTTAAATGGTTGTTGGAATTACTCCTAAACCAGGTATTTCTGAATAAACAGCCATCTAGAATCTGTTATGGATCAGTGCCTGCATTTCCTTTAGATTACTTTGGAGCCCTCATAAAACAATAAAGAGGCTTATTGTACCTCTGTAATTAAATTAACTTGCCCTCCTGCCTCAGATGAACACAGTGTGGTGTATTTATTAAGACGCTCTGAAATAAATCACACCGCAGAGCAATGCAAATACATTAATATCATAATAAAGCTTGTAAGGGAGAGCTGTTCATCAGCTGTCACTGTTTTTGTTTGTCACACTGAGGATGAATGGCTTTATTTCCTAAAATTCTCATCTCGCCTTGCTGCGCATTAATGTGTATGTATGCAAACAAAGCTGCCTTGCCGTTCGACGGAGAACGCTGGGTTTGATGAAACGCCTGGTGGGGGAGGTGGTGAAATGCAGAGAGCATCTACAGTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30066
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006930 Nonsense 1170 2234 26 49
ENSDART00000142473 None None 318 None 9
Genomic Location (Zv9):
Chromosome 24 (position 15102048)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 15053496
GRCz11 24 15197915
KASP Assay ID:
2261-8553.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCAAGCAGAATCAATCTGAACTGGACCAGCAGGACCTTAAATGGTTGT[T/A]GGAATTACTCCTAAACCAGGTATTTCTGAATAAACAGCCATCTAGAATCT
Long Flanking Sequence:
TTGACAGTCTTCATCTTCGGAGTAGAATTGCACCATGACACCTGTACTGCGACTGTTTGGGATGAATACATGTACCGTTACATCCATAATATTAATATTGTACATGCATACAGTATATATGCTTAGTTTAATATGTAATGCAATGTGCACATCTACTTGATATATACATTTACACTTTTATTTGTTTCTTATTTCACTTTTATCACAACAACCGTTTTATTTTAAGTGCTGTATGTAGAATGATTTTTTGATCCTTTTAACTTTGTAGGTTGACTTTGTTTGGTGACAAAAGTGCACTTTAATTTCTGACTCTGCTTTGAACTTCTTTTTTTTGTGTTTATATATGCATTTATTTATTGTTTAATTATCCCACAGATTTCTGGTTGTACGTCCAGCTTGCCATCAAGATGAGAGGCTCCTGGTGGACATTCTGTCCTTCCTCAACACGTTCTTCAAGCAGAATCAATCTGAACTGGACCAGCAGGACCTTAAATGGTTGT[T/A]GGAATTACTCCTAAACCAGGTATTTCTGAATAAACAGCCATCTAGAATCTGTTATGGATCAGTGCCTGCATTTCCTTTAGATTACTTTGGAGCCCTCATAAAACAATAAAGAGGCTTATTGTACCTCTGTAATTAAATTAACTTGCCCTCCTGCCTCAGATGAACACAGTGTGGTGTATTTATTAAGACGCTCTGAAATAAATCACACCGCAGAGCAATGCAAATACATTAATATCATAATAAAGCTTGTAAGGGAGAGCTGTTCATCAGCTGTCACTGTTTTTGTTTGTCACACTGAGGATGAATGGCTTTATTTCCTAAAATTCTCATCTCGCCTTGCTGCGCATTAATGTGTATGTATGCAAACAAAGCTGCCTTGCCGTTCGACGGAGAACGCTGGGTTTGATGAAACGCCTGGTGGGGGAGGTGGTGAAATGCAGAGAGCATCTACAGTCGCTGGAGTGTTGCTCAAACATCTGTGCTGTCTAAATGAAACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44110
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006930 Nonsense 1236 2234 28 49
ENSDART00000142473 None None 318 None 9
Genomic Location (Zv9):
Chromosome 24 (position 15085065)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 15036513
GRCz11 24 15180932
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACACTTTTACTCATTCTTTTGAATTTGCCTTTTTGTTTTTCAGGATGTG[T/A]GAGGTTTTGTCTGGACCGTTTGCCTCTGAACTGTCTCTGCGTCTGCTGCA
Long Flanking Sequence:
AAAAATTTTGGACAGAGTTGAAAAGCTTGTGCGAGCAAGACAGCCTACAATTCTGACTCAGTTACACCAATTCTGTCAGCAGGAATGAAAAAAACGTAAACAATACATTTGTATTTGTTCATGTTAGTTAACCTTAGTTAATGAAAATAGATTGATTCATTGCTAGTTCTTGTTAACAAGCATGAATTTGGAATTTAATAAGGTACTAGTAAATGTTAAAATGTAAATGTAAACCTATCATTAATAAATGCTGTGTTGTGTTGTTCATACTTAGTTCATGTTAGTAAATACATTGACATGAACTAATTCACCTTATTGTAAAGTGTGACCATGTCATTTCATTTCAGTGTCAATTACTTCAGCATTAAGTATTGTTCATAGTTATTACTGTAGTCTGCAATGAATAAAAGTATTCCTCACATGATATCATCACCCTTAGTGTCAAATAATAACACTTTTACTCATTCTTTTGAATTTGCCTTTTTGTTTTTCAGGATGTG[T/A]GAGGTTTTGTCTGGACCGTTTGCCTCTGAACTGTCTCTGCGTCTGCTGCAGTGTCTGCGCCTGTCTGATGCTCCGTGCTTTTACGGCCTGCCGTCTCTAGAGCGCACACTCAGGACCATGGCCCACGTGACTGCCCTGCCCGGCTGGAGCACCCACACTCCTAGCGTAGAGCCAAACACGCTCTGTCTCAAGTACCTCAGCGGCCTTCTGGAAGTATGTACACACACATGTGCTCAAGTGCCTCGGTTACACACAGAAATATACTTTGCACAGATTACATGCACACTCACTGCTCCTCACACATTAAACGCACACTCATAAGCAGAGTCCACGATGTTCCCAAACACTTAGACATGAACCACTCCAGAACCAACAAGCTCGAGTCTCAGCTGCTTTTCATCTGCTGTGCTTTGCAAGGCAGGTTTATTTGTATAGCACATTTCATACACAATGGTGGTTCAAAGTGTTTTACATAAACAAAAAAAAAAAAAGAAACATTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30065
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006930 Essential Splice Site 1350 2234 29 49
ENSDART00000142473 None None 318 None 9
Genomic Location (Zv9):
Chromosome 24 (position 15081105)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 15032553
GRCz11 24 15176972
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCCTGCTTCATTTGTCACACGAGATGATGAAGGAAAGCACAAATAAG[G/A]TCAGAAAAAGCACTGTGTTTGACACTGCTGTCAGTAGGCTTTGAAACTGA
Long Flanking Sequence:
AGCACTACTTTATAGCCATATATAATAAAACTAAACAGATAATGAAAAGTACTATTATATAATCATTTCTTTTTTAATATAATATAATATAATCTTTTTTTATATAATCATTTCAATTTTAAACATAAATATTATTTTAAATTTTAAATATATATATATATATATTTCATTAAGCAATAAAACATGTAGAGTTCCTTTTGTTATTTTACCTGTTTAACTTTTTTTGCTGCAGTTTATGTCAATATTGTAATAATTCCATATACTGTATCACAATTTAAGGAAAACAAATGTATTACTGTGACGTATACCTCTAGTGTGAAACCTCCAGATTACTAATTCTGATTTTACTTCTCTTTGACTGCTCTTCCCAGGTCATATCTTCATTCTATGTCGATTTGGGAGGAAATTCAATGTCCTTTATGGGCAAAGGAGTAACAAAAAATGCAGTGATCTGCCTGCTTCATTTGTCACACGAGATGATGAAGGAAAGCACAAATAAG[G/A]TCAGAAAAAGCACTGTGTTTGACACTGCTGTCAGTAGGCTTTGAAACTGACACAAGGGGGTGCTAACACCTTCTTTTAATCAATTTAGTAACTTTGACCAATTACAATGCTTAGCATAAATGAGTACACCCCCTTTTGAAAATGACATGCTTTTTTTTTTCATTTGTTTTTTAGTGAATATAACCAATTCTTTTGGTGCTTTTAAACAGTTATATTCATTAAAATAGGGATTTGGCCAACTAACGTTTTAAATAATAAAATAATAGAGCATTTAAATTCAAACAAGATATTGCAAAAATCAAATGCATAAGTTTATATGTGTGTCATGTTTTTTTTTCTGTTTAGTATGATTTTATATATATAATATAGTTTTATATTTTAGTTATAGTTTATATAGTTTTTTTGTTAGATTAATTCCAGTTTTAGCTTTGGTACTGACTAATCTAATGCATATGCACAAATATATCGTTGTAAATCATCCTATAGAAAAGATTCATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37847
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006930 Nonsense 1762 2234 39 49
ENSDART00000142473 None None 318 None 9
Genomic Location (Zv9):
Chromosome 24 (position 15066761)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 15018209
GRCz11 24 15162628
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACCTGGTCGGATGTGTTGACGCTTCTGGCTACTCTGCTGCGCAGGAAC[C/T]AAGCTGCGGTCGGCCCATCTGTCGCTGTGGCACTGGGGAAACACTGGCAG
Long Flanking Sequence:
GGCCCACAGTCAATTAGTCAACTGTTTGTTGTCCCTTATAGTTTTGTGACTCCCAAAGTGCTGTATTTGTGTTTTCTGATTGACTCTCCCAACTGACTCTCCCTCATTTTCTCTCTCTTCCTCCTCCCACACCTTGTTTTTTCTCTTAGGTGCTGAGTAGCTTGTATTATGTGCAAAGTTTCTGTAAGCTCCTGCAGTCAGCAACGATACACAGTGAGGATGTGCCGCTCCACAGAGAGTACTTCAAACTCCTGCTGAACAACCTCATTTCCATCCTCACGCTGCCTGTCGCTGACTTGGGTAACACAAAACATCTTGTGCAAATCCACAACCCAGCTGAAATCTCCCCAAAAAAGTCCTTTAAATAAAAGAAGTGTGTTTTTATATAAATGTGTATGTGTGTGTGGTTGTTTTGGTCCTCAGATGCGCAGACCCAGGGTGCAGTGCTCAACACCTGGTCGGATGTGTTGACGCTTCTGGCTACTCTGCTGCGCAGGAAC[C/T]AAGCTGCGGTCGGCCCATCTGTCGCTGTGGCACTGGGGAAACACTGGCAGCGTTTTTCAGGTGACAAACACACACACACACACTAACATACACACCAAAAAAAGTGTTACAAAGAGTGGAGACAGGTGAGAGGAAAGGGAAGGCAGAATGAAACAGAAGAGTACAGAGAGAAAATGATGGCAAACATGATGAAAGCGCAAAGGGACGGAGGGGAGAGAAGGATTGAGGAGTTTAGATGGAAGAGGATGTGCTAGAAAGATGTTGAGGAGATGGAGATAGAGACAGATGCAGTGGGAGGCCGGCTCATTATGCCTGTATATGTGGATGGGTGTCCCTGCTGCATATGACAGTCTGGGACAGAGACAGGAAGAACAATCAGCCTGCTTTAGATCTGATGGATGTGGTAGAAAATCCTGAAACAGGTGGGTGGGCAGTCGACTCGCTGACTTGCCTGCAGGTATCCAGGCTTTGGAAGCATTTTTTATTATTTTTTTAAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44109
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006930 Nonsense 1978 2234 44 49
ENSDART00000142473 Nonsense 117 318 4 9
Genomic Location (Zv9):
Chromosome 24 (position 15054806)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 15006254
GRCz11 24 15150673
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCTTGATGATCTCACCATGGCAGCGGCTCTGGAACTGCTCTGCGTCTA[C/A]ACAGCGAACTGCACAGCGGGTAACTTTTCTGAAAGATGGAGAAATGAGAG
Long Flanking Sequence:
TTCGTTCTTCTGTTAAAACAAACAAACATATTTTGAAGCTGAAAAGCGTTGTTGACTTCCATAGTATTGTTTTTTTCCTTCTACGAATGTCAATAAACATCAGTTTTCAGCTTTCTTAAAGAAACCCATAAAGGTTTGGAATGAACTGATGGAGAGTAAATAGTGAGTAAATAATGTTTTTTGGGTAAACTACACATTTAATTTAAGACATGCTTTTTTTGGATGTTACATCATTTTTTTTATGTGTTTAGTAAATCCTGACAGTATTTTTTTCCAGTGCCAAGATAGGGTTTGTGTTGGCACAAGCTTTTAATAAATCTGCCCGAAGATGACTAATATTGAATGTTAGCAACAAATATTGTCTCATTTGTTGAATTAATTTTCTCCTCACAGGCTGTGGCTACAGATTTGCGTCTGGCTGTCGTGCTGTTGGCTTTTTGGCCCTGGCTCCTGCTTGATGATCTCACCATGGCAGCGGCTCTGGAACTGCTCTGCGTCTA[C/A]ACAGCGAACTGCACAGCGGGTAACTTTTCTGAAAGATGGAGAAATGAGAGCTAGAAATGGGGAATGACAGAGGGATAGAGCATTAGACAGGGATAACAGTGTGCTGAGATGATAATATATGAGCTTTTTGCTCACTGTAACCCTCTCATGAGTCATGTTACTGTACAGTAAGTGCCATTGTGTGTCAAATGCCAGGCTGACGTGAGCATGACACTTACAGAAGGGATTGTGTCATAGTCTAAGTGTGCTGCCAGATTACTGGAAAGCTAGGATGAAGCGTTTGTGTTAAGATGAGGTACTTTAGGGTAAAGATTATTTGGGCAAATTGATATATTCAGTGACTGTTAATACATTATACAATAGAGATCTAAATTAGAGAATCATATTTTGGATAATGTAGTCCACATTCAATATTTAAAGGAATTGTAGTTGTGGCTACTATAAAACATGTGAATTGGACTGTGTTTTTTTTTTACAAAAATAACCAATGTGCTTCAATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa594
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006930 Nonsense 1982 2234 44 49
ENSDART00000142473 Nonsense 121 318 4 9
Genomic Location (Zv9):
Chromosome 24 (position 15054794)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 15006242
GRCz11 24 15150661
KASP Assay ID:
554-0504.1 (used for ordering genotyping assays)
KASP Sequence:
CTCACCATGGCAGCGGCTCTGGAACTGCTCTGCGTCTACACAGCGAACTG[C/A]ACAGCGGGTAACTTTTCTGAAAGATGGAGAAATGAGAGCTAGAAATGGGG
Long Flanking Sequence:
TTAAAACAAACAAACATATTTTGAAGCTGAAAAGCGTTGTTGACTTCCATAGTATTGTTTTTTTCCTTCTACGAATGTCAATAAACATCAGTTTTCAGCTTTCTTAAAGAAACCCATAAAGGTTTGGAATGAACTGATGGAGAGTAAATAGTGAGTAAATAATGTTTTTTGGGTAAACTACACATTTAATTTAAGACATGCTTTTTTTGGATGTTACATCATTTTTTTTATGTGTTTAGTAAATCCTGACAGTATTTTTTTCCAGTGCCAAGATAGGGTTTGTGTTGGCACAAGCTTTTAATAAATCTGCCCGAAGATGACTAATATTGAATGTTAGCAACAAATATTGTCTCATTTGTTGAATTAATTTTCTCCTCACAGGCTGTGGCTACAGATTTGCGTCTGGCTGTCGTGCTGTTGGCTTTTTGGCCCTGGCTCCTGCTTGATGATCTCACCATGGCAGCGGCTCTGGAACTGCTCTGCGTCTACACAGCGAACTG[C/A]ACAGCGGGTAACTTTTCTGAAAGATGGAGAAATGAGAGCTAGAAATGGGGAATGACAGAGGGATAGAGCATTAGACAGGGATAACAGTGTGCTGAGATGATAATATATGAGCTTTTTGCTCACTGTAACCCTCTCATGAGTCATGTTACTGTACAGTAAGTGCCATTGTGTGTCAAATGCCAGGCTGACGTGAGCATGACACTTACAGAAGGGATTGTGTCATAGTCTAAGTGTGCTGCCAGATTACTGGAAAGCTAGGATGAAGCGTTTGTGTTAAGATGAGGTACTTTAGGGTAAAGATTATTTGGGCAAATTGATATATTCAGTGACTGTTAATACATTATACAATAGAGATCTAAATTAGAGAATCATATTTTGGATAATGTAGTCCACATTCAATATTTAAAGGAATTGTAGTTGTGGCTACTATAAAACATGTGAATTGGACTGTGTTTTTTTTTTACAAAAATAACCAATGTGCTTCAATCATTTTTCATAAT
Associated Phenotype:
Not determined