Busch Lab

ZMP

bach2

Ensembl ID:
ENSDARG00000004074
ZFIN ID:
ZDB-GENE-041001-139
Description:
Novel protein similar to human and mouse BTB and CNC homology 1, basic leucine zipper transcription
Human Orthologue:
BACH2
Human Description:
BTB and CNC homology 1, basic leucine zipper transcription factor 2 [Source:HGNC Symbol;Acc:14078]
Mouse Orthologue:
Bach2
Mouse Description:
BTB and CNC homology 2 Gene [Source:MGI Symbol;Acc:MGI:894679]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa23698 Nonsense Available for shipment Available now
sa37023 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19233
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028717 Nonsense 59 823 2 5
ENSDART00000131857 Nonsense 33 796 1 4
ENSDART00000028717 Nonsense 59 823 2 5
ENSDART00000131857 Nonsense 33 796 1 4
Genomic Location (Zv9):
Chromosome 20 (position 24004561)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24123362
GRCz11 20 24022462
KASP Assay ID:
2261-4295.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGACAGTGCACTGTACCAACATCCTGCTGGGTCTGAATGAGCAGCGGAAG[C/T]AGGGCCTGCTCTGCGATGTGACCGTGCTGGTGGAGGGCAAGGAGTTTCGC
Long Flanking Sequence:
CTATGGCATTGAGCAGGTTAAAATGACCAAAACAAAGACAGATGTTTCGGCATGGAAAACACATTTTCAAAGCAGAATAACTGACTGCAGCATTGTTTTTCTGATAAACAAGAATGTTCTCTTGGCATGTTTCTTAAATATCTGCAAACATGTTATGGTATTATTGTGCTTTAGAAGATTTAAAAACGTACATACAGCACCTTTAAATCATTGTTTGTTTGTTTTTTTGTTTTTTGTAATTTCTTCTGTTACTCATTTTTTCCCTTGAAATGTTGTTTCAATTTGGGGTTTAGAAAGCACTTATTTTGGAGCACCCTTAAATGTATGTTGTCATTCTGCTTTGATCACATACAGTAAGCTAATCGCTCTTTGTCTCTCTGATCTCTGTGCAGGGTGTGAGCGGTATGTCCGTGGATGAGAAGTCTGAAGCTCCCATGTACGTGTATGAGTCGACAGTGCACTGTACCAACATCCTGCTGGGTCTGAATGAGCAGCGGAAG[C/T]AGGGCCTGCTCTGCGATGTGACCGTGCTGGTGGAGGGCAAGGAGTTTCGCGCACACAGGGCTGTACTAGCGGCCTGCAGCGAGTACTTCCTACAGGGGTTTGCCACCCAAACTGACAATGATCTGGTGCTCAGCATGCCAGAGGAGGTACGGAGAAACACTTCTGCATTCACAGATTTTAAAACATTTTTTTATTGTGTTGTAGGATGACTTGACATTCCAGGGCAGCCCTTTATTTCAGCTATGTTTTTTTTGTCCAGATTTCTTTTTGTCCTGATGTTTGCTCGCTTTTTTCGCTTTTCAATAGTTCACCCAAAAATGAAAATTATTATAATATGATATTCAGTGCTTATCCACAGGTTTAAAATATACTTGCGGTGGTAGCCATCACATACACATAAATGGTTAACTATATGCGACAAACAAAACATTATTACATTTTTAGCAGTAATTTTATTTATTATGACACTGTTTTACTCTTTTTCTTTTCAATGGGTCAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4137
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028717 Nonsense 59 823 2 5
ENSDART00000131857 Nonsense 33 796 1 4
ENSDART00000028717 Nonsense 59 823 2 5
ENSDART00000131857 Nonsense 33 796 1 4
Genomic Location (Zv9):
Chromosome 20 (position 24004561)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24123362
GRCz11 20 24022462
KASP Assay ID:
2261-4295.1 (used for ordering genotyping assays)
KASP Sequence:
CGACAGTGCACTGTACCAACATCCTGCTGGGTCTGAATGAGCAGCGGAAG[C/T]AGGGCCTGCTCTGCGATGTGACCGTGCTGGTGGAGGGCAAGGAGTTTCGC
Long Flanking Sequence:
CTATGGCATTGAGCAGGTTAAAATGACCAAAACAAAGACAGATGTTTCGGCATGGAAAACACATTTTCAAAGCAGAATAACTGACTGCAGCATTGTTTTTCTGATAAACAAGAATGTTCTCTTGGCATGTTTCTTAAATATCTGCAAACATGTTATGGTATTATTGTGCTTTAGAAGATTTAAAAACGTACATACAGCACCTTTAAATCATTGTTTGTTTGTTTTTTTGTTTTTTGTAATTTCTTCTGTTACTCATTTTTTCCCTTGAAATGTTGTTTCAATTTGGGGTTTAGAAAGCACTTATTTTGGAGCACCCTTAAATGTATGTTGTCATTCTGCTTTGATCACATACAGTAAGCTAATCGCTCTTTGTCTCTCTGATCTCTGTGCAGGGTGTGAGCGGTATGTCCGTGGATGAGAAGTCTGAAGCTCCCATGTACGTGTATGAGTCGACAGTGCACTGTACCAACATCCTGCTGGGTCTGAATGAGCAGCGGAAG[C/T]AGGGCCTGCTCTGCGATGTGACCGTGCTGGTGGAGGGCAAGGAGTTTCGCGCACACAGGGCTGTACTAGCGGCCTGCAGCGAGTACTTCCTACAGGGGTTTGCCACCCAAACTGACAATGATCTGGTGCTCAGCATGCCAGAGGAGGTACGGAGAAACACTTCTGCATTCACAGATTTTAAAACATTTTTTTATTGTGTTGTAGGATGACTTGACATTCCAGGGCAGCCCTTTATTTCAGCTATGTTTTTTTTGTCCAGATTTCTTTTTGTCCTGATGTTTGCTCGCTTTTTTCGCTTTTCAATAGTTCACCCAAAAATGAAAATTATTATAATATGATATTCAGTGCTTATCCACAGGTTTAAAATATACTTGCGGTGGTAGCCATCACATACACATAAATGGTTAACTATATGCGACAAACAAAACATTATTACATTTTTAGCAGTAATTTTATTTATTATGACACTGTTTTACTCTTTTTCTTTTCAATGGGTCAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29358
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028717 Essential Splice Site 107 823 2 5
ENSDART00000131857 Missense 82 796 1 4
Genomic Location (Zv9):
Chromosome 20 (position 24004414)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24123215
GRCz11 20 24022315
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTTTGCCACCCAAACTGACAATGATCTGGTGCTCAGCATGCCAGAGGAG[G/T]TACGGAGAAACACTTCTGCATTCACAGATTTTAAAACATTTTTTTATTGT
Long Flanking Sequence:
ACATGTTATGGTATTATTGTGCTTTAGAAGATTTAAAAACGTACATACAGCACCTTTAAATCATTGTTTGTTTGTTTTTTTGTTTTTTGTAATTTCTTCTGTTACTCATTTTTTCCCTTGAAATGTTGTTTCAATTTGGGGTTTAGAAAGCACTTATTTTGGAGCACCCTTAAATGTATGTTGTCATTCTGCTTTGATCACATACAGTAAGCTAATCGCTCTTTGTCTCTCTGATCTCTGTGCAGGGTGTGAGCGGTATGTCCGTGGATGAGAAGTCTGAAGCTCCCATGTACGTGTATGAGTCGACAGTGCACTGTACCAACATCCTGCTGGGTCTGAATGAGCAGCGGAAGCAGGGCCTGCTCTGCGATGTGACCGTGCTGGTGGAGGGCAAGGAGTTTCGCGCACACAGGGCTGTACTAGCGGCCTGCAGCGAGTACTTCCTACAGGGGTTTGCCACCCAAACTGACAATGATCTGGTGCTCAGCATGCCAGAGGAG[G/T]TACGGAGAAACACTTCTGCATTCACAGATTTTAAAACATTTTTTTATTGTGTTGTAGGATGACTTGACATTCCAGGGCAGCCCTTTATTTCAGCTATGTTTTTTTTGTCCAGATTTCTTTTTGTCCTGATGTTTGCTCGCTTTTTTCGCTTTTCAATAGTTCACCCAAAAATGAAAATTATTATAATATGATATTCAGTGCTTATCCACAGGTTTAAAATATACTTGCGGTGGTAGCCATCACATACACATAAATGGTTAACTATATGCGACAAACAAAACATTATTACATTTTTAGCAGTAATTTTATTTATTATGACACTGTTTTACTCTTTTTCTTTTCAATGGGTCAAAGTAAAAAAAGAAATCCACTATTTATGTTACTTTTATGCTATTCAGGAGTAGGCATGAAATAATAACCGATTTTAAGGTTTATCGTGGTTTGGAAAAGTCAAGGTTTTAAAACCACCAATGTTTTCTGCAATACCATTCCTAGGGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23698
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028717 Nonsense 500 823 3 5
ENSDART00000131857 Nonsense 473 796 2 4
Genomic Location (Zv9):
Chromosome 20 (position 23979164)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24097965
GRCz11 20 23997065
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCGCCAAAGGCCCAATACCAGCTGCCCAGTGCCAATTAAGGTATGCCCA[C/T]GATCGCCCCCTTCAGAGACCCGCACTCGGACCTCCAGTTCCTGTTCGTCC
Long Flanking Sequence:
CACCCACCTGCCTACGGGCTCTGTTCAAGAAGGACCTGCCCAGCACACCCCAGCAGCTCTTAGCTAACAGACTCATCAACGCCCAGGATAAAGGAACCACTCAGGGAGACCACAAAAAAGACTACAGGCCTTCGCTTGGCAATGAGTTTGGCATGCCTGTGGCGTTCCCCAAAGACACTGATGGTTTCCCGCCAGGGCTTTCGTTGAAGTCGCCTTCCTGCGATGGTGTGTGCAAGCAAGAGGTGGAGCCGGACCGCCGCAGTGTCATCTTCTCCTCAGGGGCCTGTGACCGACTGGGTACACCCACCCACTCCCATCCCAGCGGGAACTCATTGGAGAAGGAGCTCTCAGAACACATGCCAAAGGGATTGTGGGCCGGCGCCAGCCAGTCCCTTCCCAGCTCTCAGACCTACTCCCCTAGTACCACAGCCAGCGACCCGCCCTTGCTTTGCCGCCAAAGGCCCAATACCAGCTGCCCAGTGCCAATTAAGGTATGCCCA[C/T]GATCGCCCCCTTCAGAGACCCGCACTCGGACCTCCAGTTCCTGTTCGTCCTATTCTTACGCTGAGGACGGAAGCGGGGGGTCCCCCTGCAGCCTGCCGCAGTTTGAGTTTTCACCCTCGCCTTGCCCCAATGTGACGCGGTGTCTCACCTCTGACCAACAAGAGGCAGGTGGTGGGACGGATGCACTATTTGCACGGGTACGGCCCAAGATAAAGTGTGAGCAGTCATATGGAACCAATTCCAGTGATGAGTCAGGGTCCTTTTCGGAGGGGGACAGTGAATCATGTCATGTTCGAGAGCAAGGCCCTGAGGTGAGTCTGTTGAATTTTTTTTCTCTCATTGTGTTTACCAATAATTTTTTCCAGAACCTCACTATGCATTTTCTAGCTTCCATTCATGCAGAAAGCAATTAGATAACGCATGCTCCTTCATGCTATCAGAGACTTCCCTTTTGATCTCTATTTACTTCTTCATTGAATAAAGCTGCTGACTGCTAATAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7933
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028717 Nonsense 654 823 4 5
ENSDART00000131857 Nonsense 627 796 3 4
Genomic Location (Zv9):
Chromosome 20 (position 23960188)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24078989
GRCz11 20 23978089
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCCACGACGTGCGCAGACGTAGTAAAAATCGCATCGCGGCACAGCGCTG[C/A]CGCAAGAGAAAACTTGACTGCATCCTGAACCTTGAGTGTGAAATACGCAA
Long Flanking Sequence:
TATTAAACACACCTGAACCAATTAATTAGGACCTGAACACCATGTGATAATTTCAGGCAGGTGTGTTTGATATGGGTTGCAACTGAAATCTGCAGCAAGGTGGTTCTCTAGGAACAGGGTTGGCCACCCCTGTAATAGACAATCTACATAATCTCTCCTTGTTCTAGCTTGTACTCCAATCTGAGAATGTGTAGTGTGTAGGGACCACCTTAGCTTCTCAGGTATCCATTATTTTCTGTTAACTCAATCAATCGTTATCAACTATTCCTGACATAAATGTGCCTTTTTTTTTTAACTTTATCGTCATTGTTATAGGTTTTAATCATATGCCCATGTTTGTCTTTACAGGTCAAGCTCCCGTTCCCTGTTGATCAAATCACAAATCTTCCACGCAACGACTTCCAAATGATGGTGAAAATGCACAAGCTGACCTCAGAGCAGCTGGAGTTCATCCACGACGTGCGCAGACGTAGTAAAAATCGCATCGCGGCACAGCGCTG[C/A]CGCAAGAGAAAACTTGACTGCATCCTGAACCTTGAGTGTGAAATACGCAAACTGGTGAGTACACAAATGTCTCTGTCACACTGAGTGTGACAAAACATCGGCCTTCAAAAAAAAGCAGAGGCAGCAGGAGGTCTGGTCTCCTATGCGGTCATGGCGAACCGTTACCTGTCAATCACAGAGCCTGTGCCATGCTGTTTGGCTGATGGAGGCGGAGCCCACTGTCTTTGATGTGTCTACATATGACAGTTGGCACTTTGATGCCACATGCACATCCTCTATATAATGTCCCAGAAAGCAGCAGGAGATGCCTCTGCTTCTACTCGGCCGTCCTCTTATCTTCAGAGTTTGACAGCTGTATTAAAGCACAACTGAAAAGAAGCTGTAGCATGAATGTATGTATGAAGACGGGAGATGTGTGAAGTATGTCGATCTCTGTGGAGATTGAGAGAGAAGGCAGTGTTAGTGCTGCAGGGTGACCTACTTACTGTAACTCAGCCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37023
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028717 Nonsense 816 823 5 5
ENSDART00000131857 Nonsense 789 796 4 4
Genomic Location (Zv9):
Chromosome 20 (position 23956751)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24075552
GRCz11 20 23974652
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACAGTAGACTTCTGTCAAGAGATGACAGATAAATGTACAACTGACGAA[C/T]AGCCCAACAGAAAGGACTGTACCTAATGACGGTGGTTTCTCTGTGTTGAT
Long Flanking Sequence:
AGTTCCAGCAAAAATCACAATGACTATGATCTGGCTGTGATATGTGTGTTTTGTGTGTGTCCACCCTACAGGTGTGTGAAAAGGAGAAGCTGTTAACAGAGCGCAACCAGTTAAAGGCGTGCATGGGAGAGTTATGGGAGAATTTCTCCTGTCTGTCGGAAGAGGTGTGTCGAGATGTGCAGCTGAGCCCTGAACAGGTACATCACTACTGCCCTATACTGCGCCCCGGCAACACCGCCTCCGTCGCCCCCGGCAGCATCGACCTCACCGCCTCCTCCACCCCAGAACAGAGCTTCCACAAATCATCCTCCACAAAAGACGGGACAACCCGAAAGCCCCAGTGGAAAACTGGCAACGGGGCTGAAGACGCAGCCAACCACAGGGAGGAGCAAGAGGCCGGCTCTGCCTTTATGGAGGTGGGGCTTTCCCTGGAACAGTCCAATCAAACGGTGACAGTAGACTTCTGTCAAGAGATGACAGATAAATGTACAACTGACGAA[C/T]AGCCCAACAGAAAGGACTGTACCTAATGACGGTGGTTTCTCTGTGTTGATTTGTTTTTTATTATTATTTAATTTAGTTATGTCTTCTGACAAACCCTCACAAGTCGAGGGCTGTTGAGATGGCCAGCCTCTGCCAGTGTTTTTGATTTTTTTTTACATATATATATATATATATATATTTATGTCTTTTTATTGTCTTTTTTTAAACAAAGGTTGACACTACAGTTGTCTTAACAGCAGCAATACTGTTCTCCAGGTTCTGTCTAGTTCAGCCATGGCAGAGTGGCTGAGACCTTCTCACAGAACTTCACAATGGTGCTACACCTTTCCAGGACAGTGGAGACACTGTCTGTTTCCAATTACAGTCCATTCAGTTGGGATGGGCGCTGACCACATCTCAAATTCAGACCTCTACGGACCTAGCAGCAGCTTTTTGCTCTCTTTTTGTCTCTTTCTTCCCTCTCCACCTTCATTCACTCCTCCTGCCCTCTACCTCTAAAT
Associated Phenotype:
Not determined