Busch Lab

ZMP

bhlhe40

Ensembl ID:
ENSDARG00000004060
ZFIN ID:
ZDB-GENE-030131-3133
Description:
class E basic helix-loop-helix protein 40 [Source:RefSeq peptide;Acc:NP_997844]
Human Orthologue:
BHLHE40
Human Description:
basic helix-loop-helix family, member e40 [Source:HGNC Symbol;Acc:1046]
Mouse Orthologue:
Bhlhe40
Mouse Description:
basic helix-loop-helix family, member e40 Gene [Source:MGI Symbol;Acc:MGI:1097714]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa16419 Nonsense Available for shipment Available now
sa38854 Nonsense Mutation detected in F1 DNA Not yet available
sa21951 Essential Splice Site Available for shipment Available now
sa35135 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16419
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026017 Nonsense 56 403 3 5
ENSDART00000128382 Nonsense 56 403 3 6
Genomic Location (Zv9):
Chromosome 11 (position 36603369)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 35500597
GRCz11 11 35762580
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATAGTTTTATCTGCTGACCCCYAGGAWACGTACAAACTGCCTCATCGAT[T/A]GATCGAGAAGAAAAGAAGAGACCGAATAAACGAGTGCATCGCGCAGTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38854
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026017 Nonsense 112 403 4 5
ENSDART00000128382 Nonsense 112 403 4 6
Genomic Location (Zv9):
Chromosome 11 (position 36602832)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 35500060
GRCz11 11 35762043
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTCACACTCAAGCATGTGAAGGCTCTTAACAACCTGCTGGAACAGCAA[C/T]AACAGAAGATCATTTCCTTGCAGAATGGATTGCAAATCGGTGAGTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21951
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026017 Essential Splice Site 124 403 4 5
ENSDART00000128382 Essential Splice Site 124 403 4 6
Genomic Location (Zv9):
Chromosome 11 (position 36602792)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 35500020
GRCz11 11 35762003
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAACAGCAACAACAGAAGATCATTTCCTTGCAGAATGGATTGCAAATCG[G/A]TGAGTTTTTGATAATACCAAAAGGTCGGCACATCAAATGTGTGACCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35135
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026017 Nonsense 246 403 5 5
ENSDART00000128382 Nonsense 246 403 5 6
Genomic Location (Zv9):
Chromosome 11 (position 36602199)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 35499427
GRCz11 11 35761410
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCAGAGCGGGAGTGATACGGACACCGACAGTGGCTATGGGGGCGAGTA[C/A]GAGAAGCGTGACCAGAAAGCTCAGCGGCCGGACTGCTACGTAAAAGAAAG
Associated Phenotype:
Not determined