Busch Lab

ZMP

uhrf1bp1l

Ensembl ID:
ENSDARG00000004055
ZFIN ID:
ZDB-GENE-041210-177
Description:
UHRF1-binding protein 1-like [Source:RefSeq peptide;Acc:NP_001093475]
Human Orthologue:
UHRF1BP1L
Human Description:
UHRF1 binding protein 1-like [Source:HGNC Symbol;Acc:29102]
Mouse Orthologue:
Uhrf1bp1l
Mouse Description:
UHRF1 (ICBP90) binding protein 1-like Gene [Source:MGI Symbol;Acc:MGI:2442888]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa16858 Essential Splice Site Available for shipment Available now
sa10068 Essential Splice Site Available for shipment Available now
sa14650 Essential Splice Site Available for shipment Available now
sa33448 Nonsense Mutation detected in F1 DNA Not yet available
sa40271 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20255 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16858
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046871 Essential Splice Site 55 1402 None 20
ENSDART00000135330 Essential Splice Site 69 1416 None 21
Genomic Location (Zv9):
Chromosome 4 (position 17330025)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18272865
GRCz11 4 18261841
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACCTGGCTCGCCATTAATAAAGTCTTCTGCAATAAAGCYGCCATCCGGG[T/C]AAGAGACACGTCTGCTCGTTCAAGACAKCATCACTTTGAGTCCCTCTCAT
Long Flanking Sequence:
GAATTTTTCCTCCAAAAATGATACTCAGCTGCAATGTTCTCAGTGGCTCAGATGTCAGGAGTCTGCTGAGACTTTCATGTTCATTGCTTCATCCAACTAGAACATTTGGAGTGTTTATCAGGCACCGACATTGTAAATGGGGATTGTGGTAAATAAGTAAAATCTGAATGGCACTTTTTAGTTTAGTAATATAAAATTATCGGGTTTTTCTTGGTTCTGTGCTTTTTGAGGTTGGTAGAATTACACAGCGTTTAAACACTGAAAAGTCACATTTTCATGATGTGTTACTTTTATTTGTACTGACTTTTCCCCCCTTCTTTTTCTCTCTGTCTGCAGGTTTGCTAAGAACCTGTCTCCAGATAAGATTAATCTGAGCACTCTGAAAGGGGAGGGCCAGCTTACCAACCTGGAGCTGGATGAGGAGGTGCTGCAGAACATGCTGGATCTGCCCACCTGGCTCGCCATTAATAAAGTCTTCTGCAATAAAGCCGCCATCCGGG[T/C]AAGAGACACGTCTGCTCGTTCAAGACATCATCACTTTGAGTCCCTCTCATGCTGTAAATGAAGGATATGCTGGGATGATAATTGCACTCTTGGGCTGCAGCCAAATATACTTAATATAACTATCCTGAGATGGGAATTAATGCAGAAGCACAGTGTATGCGTACAATCTTGGTTACTAGACAGTTATTTGTTTGTTATGTCAGACACTGTTGTATATTTGATTAATATTTAAGATTTTCGCACTTGTAATCTAGTAATAATTTGATCTAGTACTTGTCAGTTAGTTTTTAAAATAAATTATTTTTGATAACATCTTTAACAAATGTAAAAAAAGTCCCTAAGGTACATAATGTGGTCTAAATAAAACTAAAGTGTTTTTGTAATGTATTTGTTTTATTCAACATTTGCTTTAATGTACTATATTAGTATTCCTGTAACAGGTAACATAATGTTCCATACACTTACTATAGTTATTACATTGAATTATGCACAACTAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10068
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046871 Essential Splice Site 266 1402 6 20
ENSDART00000135330 Essential Splice Site 280 1416 7 21
Genomic Location (Zv9):
Chromosome 4 (position 17317566)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18260406
GRCz11 4 18249382
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAGAAATCMGCTTCGCARAGGAAGAGCATGGCCCCYGACACTACACAGG[T/C]GCGAGTTTGAGGACTCTTCCCTKCCTCCTACCCCARTCACCACCACCAAC
Long Flanking Sequence:
TTGCCCTAATTAACCTAATTCAGCATTTTAATTGCACTTTAAGCTCAATACTAATATCTTTAAAAATGACTAGTAACATTCTGTACTGTCATCATGACAAAGACAAAATACATTAGTTTTTAAAAATCTTATGTTTAAAAAAATTATAGAAAAAAAAACAACAACTTCTCTTCATTAAACAACACTTGGGAAATATTAGAGAAGAACTCATTTCCCAGGACGGCTAATAATTTTCCCTCCAACTATATACTATTTTAAATATGTGTTTCTCTATTGATTTAAATAACACAATGTTCATCTTGGCTCTATACACGTATGTGTTTTCCAGATGAAGGACTGTAATGTGATTGCATCAAAGCTGACTCTGATCCTGGATGACCTGCTCTGGGTGCTGACGGACTCTCAGCTCAAGGCCATGGTGCAGTACGCTAAGTCTCTTAGTGAATCCATGGAGAAATCCGCTTCGCAAAGGAAGAGCATGGCCCCTGACACTACACAGG[T/C]GCGAGTTTGAGGACTCTTCCCTGCCTCCTACCCCAATCACCACCACCAACTACCTCTTTTTTTTAATATATGCTTTCGATTCTTAAAATACTGCTTTGCTGCTCCCTACTGGTTGTATCTTTTATTGTTCCCTTTCAGATGTCTGTATGTTTAGTATTATCAAACCTTTAGTCACGGCTGATTGATGTTTTCAGGTGACACCGGCACCCCCCACAGCCCAGCAGATGCGCACGCAGCAGGCTTCAGCCGCGGCAGATCAGACCGCTTCCATGGCACGGCTCTTCACCGCCTATGATGTTCGTGAGACGTCACACCACCTCCAGATCACACACTTGGACCTGCATATCTGCGATGACACCAATGCCAAGGATAGAGGTACCACATGTTCACACATAATACAGTTAACATTTACGTTTGGTGTTGTCATTCTAAAATACGTCTTTTCTTTGAAATCTGCAGGAATTAATAAGAGATTGGATGGTGGTGCAATGCAATTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14650
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046871 Essential Splice Site 355 1402 8 20
ENSDART00000135330 Essential Splice Site 369 1416 9 21
Genomic Location (Zv9):
Chromosome 4 (position 17317021)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18259861
GRCz11 4 18248837
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTCTTTTAGTTCTATCAGYGTAGACTATTACCCTTTCCACAAAGCTGG[T/C]AATAYATTARATACATTATTTGTACTATACTTTTGAAGAGGAAARTRTTR
Long Flanking Sequence:
ACCAACTACCTCTTTTTTTTAATATATGCTTTCGATTCTTAAAATACTGCTTTGCTGCTCCCTACTGGTTGTATCTTTTATTGTTCCCTTTCAGATGTCTGTATGTTTAGTATTATCAAACCTTTAGTCACGGCTGATTGATGTTTTCAGGTGACACCGGCACCCCCCACAGCCCAGCAGATGCGCACGCAGCAGGCTTCAGCCGCGGCAGATCAGACCGCTTCCATGGCACGGCTCTTCACCGCCTATGATGTTCGTGAGACGTCACACCACCTCCAGATCACACACTTGGACCTGCATATCTGCGATGACACCAATGCCAAGGATAGAGGTACCACATGTTCACACATAATACAGTTAACATTTACGTTTGGTGTTGTCATTCTAAAATACGTCTTTTCTTTGAAATCTGCAGGAATTAATAAGAGATTGGATGGTGGTGCAATGCAATTGTCTTTTAGTTCTATCAGCGTAGACTATTACCCTTTCCACAAAGCTGG[T/C]AATACATTAAATACATTATTTGTACTATACTTTTGAAGAGGAAAGTGTTATGATTATTAAAAGATGATCTTTTTGTGTCTCAGGTGAGGGCTGTTTGCATTGGATGCACTATGGCGAAGCAACAAAATCTCGTGAAACCTGGGCGCGTTCTCTCCTGGACGAGTTTAAGTCTAATGTCGATATGCTGAAAAACGCAGTCAGCGGACAGTCCCAGGGCTCTCCTCAGCACGGTGAGAACAGCATGCCTGTTAGCAGACTCCGATTGGCTCACTGTTGCTGAAAAATGGGTGAATGTCATTACTCCTTTCCTAATGTCTGGATTATATTTGACCCAAAAATCCAAGAAATAATTAAGAACCAATTTTGTGCACTCATAAGTCTTATATTTTGCAGTTAGGGAAGTGTTTTTAGAACAATTAAGCTTTTTTTGCTTTTCATTTTCCATATTAATTTAATTATTAGCCTCCCTTTGAATTTATTTTCTTTTTTAAATATTTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33448
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046871 Nonsense 457 1402 11 20
ENSDART00000135330 Nonsense 471 1416 12 21
Genomic Location (Zv9):
Chromosome 4 (position 17311135)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18253975
GRCz11 4 18242951
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTCTTCAGCAGACCAGCCACGCTCTAGTCCTCAAACCATGATATCCTG[C/A]AATAAGAAATCCCTCTATCTCCCCCAAGAGATGCCGGCTATTCACGCCGA
Long Flanking Sequence:
CAAAATTAAAGTGCAGCTTTTCGCATATAGTGTCTTATTGCTTATCGTCATAAATTAAAATAAGGACGCATGACAGCTGAGCGGGACTCTGACCAATGTTAGGAGAGTTTACTCGCACGTGACTTGTTTTAGCTGTTTTGGTCTGTTTAGAAACTTTGCCGTGTGAAAGCGAACTACACCAAGAACAAAGTGCAACAATGTAACAATTTAATCCCTGTTTCGGAACAAACCAATTGATCTACAGGTGTAAAAGTGCCCTTAGTCCTCTTAGGTGTACTTGACTCGCATGCAGATACGATGTAATGTGGTGCCAGGCTTGATATAAAATAACAAAGTATGTTAGATCAGTCATCCAGTATTCCAGATCTAGTCATTCTGTTACTAAGTAAATGATGAAATTTGCATTGATGAGAAACCATTTAAAAGTAAAAATATTTGACTATGTTAAAGGTGTCTTCAGCAGACCAGCCACGCTCTAGTCCTCAAACCATGATATCCTG[C/A]AATAAGAAATCCCTCTATCTCCCCCAAGAGATGCCGGCTATTCACGCCGAATTCACAGAGTACTACTTCCCAGATGGCAAGGACTATCCAGGTAAAACAGAAGGGATCCCATCCATCAGAATGTTCAGCTTTTTCTGCTTCTACTCAAGCGTTCTCTGAATTGACAATGAACACACTCTCTCCCTGCAGTCCCTTGTCCCAACCTCTATGTGCAGTTGAACGCACTACAACTGGTGCTTGACTCGAGAAGTCTGGTTTGGCTTAATCTGTTCGCACTGGACCTTCGGCAGAGTTTGGAGCAATTCATGGATCTGTACAAACTCAATGACTCACAGAAGCCTGAAGAACATGTAGATATCAAAGTGGATGGACTCATGCTTAAGGTAGACATTTAATTGAGGTTGTAAACTTTCTGTGAATTTTGGATTGACAGCTGTTTCTCAGATTATGTGCATCTAAGGTACCTCATGTTGACTATGATGCAACCCCTTTCCTAGCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3492
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046871 Nonsense 486 1402 11 20
ENSDART00000135330 Nonsense 500 1416 12 21
Genomic Location (Zv9):
Chromosome 4 (position 17311048)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18253888
GRCz11 4 18242864
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTATTCACGCCGAATTCACAGAGTACTACTTCCCAGATGGCAAGGACTA[T/A]CCAGGTAAAACAGAAGGGATCCCATCCATCAGAATGTTCAGCTTTTTCTG
Long Flanking Sequence:
TCTGACCAATGTTAGGAGAGTTTACTCGCACGTGACTTGTTTTAGCTGTTTTGGTCTGTTTAGAAACTTTGCCGTGTGAAAGCGAACTACACCAAGAACAAAGTGCAACAATGTAACAATTTAATCCCTGTTTCGGAACAAACCAATTGATCTACAGGTGTAAAAGTGCCCTTAGTCCTCTTAGGTGTACTTGACTCGCATGCAGATACGATGTAATGTGGTGCCAGGCTTGATATAAAATAACAAAGTATGTTAGATCAGTCATCCAGTATTCCAGATCTAGTCATTCTGTTACTAAGTAAATGATGAAATTTGCATTGATGAGAAACCATTTAAAAGTAAAAATATTTGACTATGTTAAAGGTGTCTTCAGCAGACCAGCCACGCTCTAGTCCTCAAACCATGATATCCTGCAATAAGAAATCCCTCTATCTCCCCCAAGAGATGCCGGCTATTCACGCCGAATTCACAGAGTACTACTTCCCAGATGGCAAGGACTA[T/A]CCAGGTAAAACAGAAGGGATCCCATCCATCAGAATGTTCAGCTTTTTCTGCTTCTACTCAAGCGTTCTCTGAATTGACAATGAACACACTCTCTCCCTGCAGTCCCTTGTCCCAACCTCTATGTGCAGTTGAACGCACTACAACTGGTGCTTGACTCGAGAAGTCTGGTTTGGCTTAATCTGTTCGCACTGGACCTTCGGCAGAGTTTGGAGCAATTCATGGATCTGTACAAACTCAATGACTCACAGAAGCCTGAAGAACATGTAGATATCAAAGTGGATGGACTCATGCTTAAGGTAGACATTTAATTGAGGTTGTAAACTTTCTGTGAATTTTGGATTGACAGCTGTTTCTCAGATTATGTGCATCTAAGGTACCTCATGTTGACTATGATGCAACCCCTTTCCTAGCTGTTGATGTAGACATTAGGGCGTTAGCAAGCTGCTTAGGTTTTTGTATTGTAAGGCAATTAACTTTGGTTCAGAAATTGAGGTTGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40271
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046871 Essential Splice Site 1033 1402 14 20
ENSDART00000135330 Essential Splice Site 1047 1416 15 21
Genomic Location (Zv9):
Chromosome 4 (position 17305628)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18248468
GRCz11 4 18237444
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCACTTGTGCTAGAACTCACCGTTGCTATTTCTTGTGCCTGTACTCTGC[A/C]GTGGTCGTTTGATGCAGGGCAAGTCGCAGTCAAGTTTCTCAGTGTCCTAT
Long Flanking Sequence:
TTTTGAGAGTAAAACACAATGCACAACTGTATTGTTTGACTGAATGTGACCTCTGGGCATATGTGTGTTTGTTCACTCTCTCTCTTCTGAAGGAAAGGCAGTTTTTCAGTGGTCTCTGACCTCTTATCCTCCACGCACAGCAGGTCTACCTCCTTATATTCCATATCCAACATGTAAGACACCCTCTGTAGGACTCTGTGGCCATCTGTGTATGCGTGAATGTTTGTGGACAAAACTGTGGTGTTGTGACTGTAATCATTTCACTCTAGCTTGTCCCTTGTAGTGATGTGTGTAGGACTGTGGACGTCTGCAGGGTTTGCCGATTCGATTGCTGATTGGTGTTTTGATTTTGCAAGAATTGTTTCGTACTTGCACCCAAACTCTCTTTTTGTTGTTGTTGTTGTATTGGTCTCATTCTTTTTTTTATTTATGTTAGCAAAGATAGGTTCATCCACTTGTGCTAGAACTCACCGTTGCTATTTCTTGTGCCTGTACTCTGC[A/C]GTGGTCGTTTGATGCAGGGCAAGTCGCAGTCAAGTTTCTCAGTGTCCTATAAGAATATGAAGAAAAGTCCTTCACTACAGTCTTTGGATGATCTCTCCATGGACAGCTATCTACTAGAGGACTGTGACAGCTACAGCCTGCTGGACAGAGGTACATGCACAAACACATTTCACTCAGGCAGTGGATTCATTTTACGTTTGTCACCACAAGGTGGCAGTATTGCAGCATAAATCTTTTTGTGTCATTTTTGTTCCTTTGCTGGAGCTGTAGGAATTTTTTTTGTTCTTAACCAAAAAAGCGTTAATTTACGTACCTTTGAATTTAAAATAAAGCTTAGTATCAGTATGTTAGTCTTAACGATATCTATAAAATATGTTCTCCAAAACTGTTACTAGATTTTCATTTAGATGAGATAAACATCCAAAACTTACAGTTTGTCACTTCAGCAGCATAAATGAATAATTTATATTTTGATGTCACCACGTACTTACGGAATCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20255
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046871 Nonsense 1365 1402 20 20
ENSDART00000135330 Nonsense 1379 1416 21 21
Genomic Location (Zv9):
Chromosome 4 (position 17277623)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18220463
GRCz11 4 18209439
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATGATCTTTTTCCATCCACACAGCTGCTCGTGGAGGAGAATGAATGCT[T/A]GAAGCTGGAGCTCTCCAAAGCCAAGATGGCGTTAGCAGAAGCGCAGATGG
Long Flanking Sequence:
TACACTTATGCAAATACATGCATTTATTAGTAAATATGTGTATTTAGTTATATATGTTTATTACATAATATTTATTATTATTTAAAAGTTATAATGAAAGATATGTTAATGCGCAGAAACAGTTAGAGGCCCTCAGTGAAAATGAGTTTGACACCCAAGGCTTAAATGCTGTGCTGGGTTGTAAGTAGCAGCTACAGCTTTGCACGTTCTTCTGAAAACGCCATTGTTAGTTATATATGACTGACATTGTATTTATATCAACATCTTGTCATCTTGAATTGCAGGTGCCACAAAACAATAACCTGAGTACTATTTATAAGTGATCCTTGTATGGGGAAAAACAATTAATAGCTTACAACATGACCCCTTCAATATCAATTATACAATGAGGATTATCACTCAAGGAAAGCGATCCAGGCTGACAAACTACAAGCGGCGTGTGTGCCAAGCTAATGATCTTTTTCCATCCACACAGCTGCTCGTGGAGGAGAATGAATGCT[T/A]GAAGCTGGAGCTCTCCAAAGCCAAGATGGCGTTAGCAGAAGCGCAGATGGAGAAAGACTCTCTCCAGCATCAAATGAAGACGCTTAAACTCACCAGCGGGGGCAGCAATAGCTAGTGTGTGTATGTGTTTGTGAGTGTGTGTTCAAACAGGACAGACACTCGCCACAGGGGAGCAGCAGAGGGCTTGAAGGGGCCCGGAGCCATAGCAAATCCCAAATCTGCAGCAGAGAAGATGATAGTGTGTGTGTGTGTGTGTGTGATGGAGATCCAGAGCAAATCAAAGAATAGTGTTTTTTTTATTGTAATGTACACACAATCAGATCATGTGTTGCAAAAAAAAAAAAAAAAACTCTTCGGAGCCTGTGGAGCTTCACATACTTTTTTTTTTTTGCTTTTATTATTTACTTGCGCTCTTCGTTTGCAGTGTAGAAGCACATTCCACCCTTGACCTTTGACCCCAGGACAGTCTTACACTGATAGTGTTGAATGTCATATCTATG
Associated Phenotype:
Not determined