Busch Lab

ZMP

cog2

Ensembl ID:
ENSDARG00000004037
ZFIN ID:
ZDB-GENE-040426-2671
Description:
conserved oligomeric Golgi complex subunit 2 [Source:RefSeq peptide;Acc:NP_998519]
Human Orthologue:
COG2
Human Description:
component of oligomeric golgi complex 2 [Source:HGNC Symbol;Acc:6546]
Mouse Orthologue:
Cog2
Mouse Description:
component of oligomeric golgi complex 2 Gene [Source:MGI Symbol;Acc:MGI:1923582]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa12307 Essential Splice Site Available for shipment Available now
sa18123 Essential Splice Site Available for shipment Available now
sa8649 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12578 Essential Splice Site Available for shipment Available now
sa8564 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12307
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026189 Essential Splice Site 74 730 2 18
ENSDART00000026189 Essential Splice Site 74 730 2 18
ENSDART00000026189 Essential Splice Site 74 730 2 18
Genomic Location (Zv9):
Chromosome 13 (position 24240587)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23886247
GRCz11 13 24016697
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTTATTAATAAAGACTATGCAGATTTCGTYAAYCTCTCCACCAATCTTG[T/A]AAGTSTTTGGTCTTTATTAACATTACTTTATCAGCAGAATTGTGTGCTAC
Long Flanking Sequence:
ATTGTGCACAGAACCAGAAATCCTCATCATCTCAAATCTCGGAAATCTTCAAACATGCCAAATATAAAAATTCTACTGAGTATAGCTGAAATATGTTATCAAGTTGAAATTCATGTTTAATAAGTTCTCTTGTGGTTATGAAGAGTCCTGAAATATTAACTTGATACTTAAATATATTTTAACACGGTTGACTGTTCTCTTAAACCCCAAACAGAATTGAAACTAATTAATTGAAACTCAGATTGTTTATAAATAAATTTTTTAAGCATTTCTGACATTATTTAGCATCATATTTCTACTTGATTTTTTGAATATTTATTTGTATGTTTCCATGCAGGATGACTTCGACGTGGACAAATTTGTGGCTGACTGCCGAAAGCGTGTCCAGTTGGAGGAGATGCGTGAAGATCTGGAGCAATATTACAGACTCCTCAAAACAGCCATGGTTGAGCTTATTAATAAAGACTATGCAGATTTCGTTAACCTCTCCACCAATCTTG[T/A]AAGTCTTTGGTCTTTATTAACATTACTTTATCAGCAGAATTGTGTGCTACTGTAAAGTGTGCTTTATGTCTTATTTCTAGTGCAAGATTATGTCATTTTTGCTATGTAAGCATGTATTTGTGTTTTAGGTTGGGATGGATAAAGCCCTCAATCAGCTGTCTGTTCCACTCGGCCAGTTACGTGAAGAGGTGCTGGTAAGTGCTTAACACATCCCTGAATATTTATGGATTGGCCATATTTCATCAAGTCAATATCTAAGTATGTTCCTGTCATCAACAGAGTTTACGATCCGCTGTGAATGAAGTTATTGAAGCTATAGACACCCAGTTGTCCAAGCAGGATGACATTCAGAAAAAGAAGGTAGGGCATGATGCGAAAACTTCATTTATTTTATTTTGAAATATGATTTTACCACTTTACACATGTTGATCAATAATATTGTGTCCCGTGCAGCTCTGTGTGTTAAGACTGATTCAAGTTGTGAGATCAGTAGAGAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18123
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026189 Essential Splice Site 74 730 2 18
ENSDART00000026189 Essential Splice Site 74 730 2 18
ENSDART00000026189 Essential Splice Site 74 730 2 18
Genomic Location (Zv9):
Chromosome 13 (position 24240587)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23886247
GRCz11 13 24016697
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTTATTAATAAAGACTATGCAGATTTCGTYAAYCTCTCCACCAATCTTG[T/C]AAGTSTTTGGTCTTTATTAACATTACTTTATCAGCAGAATTGTGTGCTAC
Long Flanking Sequence:
ATTGTGCACAGAACCAGAAATCCTCATCATCTCAAATCTCGGAAATCTTCAAACATGCCAAATATAAAAATTCTACTGAGTATAGCTGAAATATGTTATCAAGTTGAAATTCATGTTTAATAAGTTCTCTTGTGGTTATGAAGAGTCCTGAAATATTAACTTGATACTTAAATATATTTTAACACGGTTGACTGTTCTCTTAAACCCCAAACAGAATTGAAACTAATTAATTGAAACTCAGATTGTTTATAAATAAATTTTTTAAGCATTTCTGACATTATTTAGCATCATATTTCTACTTGATTTTTTGAATATTTATTTGTATGTTTCCATGCAGGATGACTTCGACGTGGACAAATTTGTGGCTGACTGCCGAAAGCGTGTCCAGTTGGAGGAGATGCGTGAAGATCTGGAGCAATATTACAGACTCCTCAAAACAGCCATGGTTGAGCTTATTAATAAAGACTATGCAGATTTCGTTAACCTCTCCACCAATCTTG[T/C]AAGTCTTTGGTCTTTATTAACATTACTTTATCAGCAGAATTGTGTGCTACTGTAAAGTGTGCTTTATGTCTTATTTCTAGTGCAAGATTATGTCATTTTTGCTATGTAAGCATGTATTTGTGTTTTAGGTTGGGATGGATAAAGCCCTCAATCAGCTGTCTGTTCCACTCGGCCAGTTACGTGAAGAGGTGCTGGTAAGTGCTTAACACATCCCTGAATATTTATGGATTGGCCATATTTCATCAAGTCAATATCTAAGTATGTTCCTGTCATCAACAGAGTTTACGATCCGCTGTGAATGAAGTTATTGAAGCTATAGACACCCAGTTGTCCAAGCAGGATGACATTCAGAAAAAGAAGGTAGGGCATGATGCGAAAACTTCATTTATTTTATTTTGAAATATGATTTTACCACTTTACACATGTTGATCAATAATATTGTGTCCCGTGCAGCTCTGTGTGTTAAGACTGATTCAAGTTGTGAGATCAGTAGAGAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8649
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026189 Essential Splice Site 74 730 2 18
ENSDART00000026189 Essential Splice Site 74 730 2 18
ENSDART00000026189 Essential Splice Site 74 730 2 18
Genomic Location (Zv9):
Chromosome 13 (position 24240587)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23886247
GRCz11 13 24016697
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTTATTAATAAAGACTATGCAGATTTCGTTAAYCTCTCCACCAATCTTG[T/C]AAGTSTTTGGTCTTTATTAACATTACTTTATCAGCAGAATTGTGTGCTAC
Long Flanking Sequence:
ATTGTGCACAGAACCAGAAATCCTCATCATCTCAAATCTCGGAAATCTTCAAACATGCCAAATATAAAAATTCTACTGAGTATAGCTGAAATATGTTATCAAGTTGAAATTCATGTTTAATAAGTTCTCTTGTGGTTATGAAGAGTCCTGAAATATTAACTTGATACTTAAATATATTTTAACACGGTTGACTGTTCTCTTAAACCCCAAACAGAATTGAAACTAATTAATTGAAACTCAGATTGTTTATAAATAAATTTTTTAAGCATTTCTGACATTATTTAGCATCATATTTCTACTTGATTTTTTGAATATTTATTTGTATGTTTCCATGCAGGATGACTTCGACGTGGACAAATTTGTGGCTGACTGCCGAAAGCGTGTCCAGTTGGAGGAGATGCGTGAAGATCTGGAGCAATATTACAGACTCCTCAAAACAGCCATGGTTGAGCTTATTAATAAAGACTATGCAGATTTCGTTAACCTCTCCACCAATCTTG[T/C]AAGTCTTTGGTCTTTATTAACATTACTTTATCAGCAGAATTGTGTGCTACTGTAAAGTGTGCTTTATGTCTTATTTCTAGTGCAAGATTATGTCATTTTTGCTATGTAAGCATGTATTTGTGTTTTAGGTTGGGATGGATAAAGCCCTCAATCAGCTGTCTGTTCCACTCGGCCAGTTACGTGAAGAGGTGCTGGTAAGTGCTTAACACATCCCTGAATATTTATGGATTGGCCATATTTCATCAAGTCAATATCTAAGTATGTTCCTGTCATCAACAGAGTTTACGATCCGCTGTGAATGAAGTTATTGAAGCTATAGACACCCAGTTGTCCAAGCAGGATGACATTCAGAAAAAGAAGGTAGGGCATGATGCGAAAACTTCATTTATTTTATTTTGAAATATGATTTTACCACTTTACACATGTTGATCAATAATATTGTGTCCCGTGCAGCTCTGTGTGTTAAGACTGATTCAAGTTGTGAGATCAGTAGAGAAGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28107
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026189 Essential Splice Site 253 730 7 18
Genomic Location (Zv9):
Chromosome 13 (position 24238085)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23883745
GRCz11 13 24014195
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGAGGCGCTGGTTGGACAGGTCTTAGTCAAACCGTACATGGATGAGG[T/A]AGATTTTGCATATCACTCAGTTGAGGCTGCACAGTCATTAGTAAGATAGT
Long Flanking Sequence:
CAATTTTTTTGTTCGCTTCTGAACCTCTAACTAGTGTTTGCATTTAAACTACACTAAGCATTGCAAATGGCTAATTTGTTGTTTGTTTTTCAGTCCACTTCTGGCAGGTCAGATTTTAGAGCGGATTGCCACTGAATTCAACCAGTTACAGTTTCATGCTGTCCAGAGCAAAGGAATGCCATTGCTTGATAAAGTCCGCCCGGTGAGCTTTTTTGAAAATTACAAGTGTTTTTAACATGACCATTTTGACACGTTTCAAATTTAAATGAGAACATTTTGATTATATGTCTGCTTACTGATTTTCTGTTCTGCGTTTCAGAGAATAGCAGGTATCACAGCTATGCTTCAGCAGTCCCTTGAAGGTTTATTGATCCAAGGCCTGCAGACGTCAAACATAGATATCGTACGCCATTGCCTCAGGACATATGCTACCATCGATAAGACCAGGGATGCAGAGGCGCTGGTTGGACAGGTCTTAGTCAAACCGTACATGGATGAGG[T/A]AGATTTTGCATATCACTCAGTTGAGGCTGCACAGTCATTAGTAAGATAGTCTCAGTATTGTGAACTTTGCAAATGGAACTGAAGCCTACAGCTTGTTTTGGAATATATCTTGTTTTGTAATATATATATATATATATATATATATATATATATAAAATTTTTTTTTTTTTTTTTTGGGCGTATTTCCACAATTGTAAATGTAATTGATTTGTTTGTGTTGAGGGCTTATAACAGGTTATAATACAGAAGTCAACAGGGTATAATACAGAACTATGCATGTAATTCATAATTACACACGACAGAAATTTACTCATCTGCCTTCCTAAACCTTTAAAAATTTACAACTTCATAAAATAGTCTCATTCTGTTTTTTTTGTTTGTTTGTTTGTTTTAAATTTGAGCCTGGTTTCTCTAGAGGTTTTTCCTTCACTTTCATCAATTGGTGAAGTTTGTTCCTCGCCAAATCAAATAATGTTCTTCCGGGCAAAAAGTCTTCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12578
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026189 Essential Splice Site 295 730 8 18
Genomic Location (Zv9):
Chromosome 13 (position 24234453)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23880113
GRCz11 13 24010563
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCATCACTGCAGACTTCTGCGAGAGGTGACCGGTGGCGCAATCTCTAGG[T/C]ATGTTTGCCACTCACATAAAACTTTTACAGCATTGAGCCATTGTWGTCAR
Long Flanking Sequence:
GATCAGCGGATCAAAAGTTATTAAACATTTAAGAGCAATACTTATTTTTAGCCGCGGGCGGCTGTCTCGGTCTTTAAGGGTTAAAACCGTTGATATGCAATTGTTCATGGTATGATAATCGTGCACGTTCAAATCGTGGTAAACCGTCATACCGGTATATTGTTACAACCCTAGTGTGAACATAACTGAGAAGGTGGCAAGCGGGGACACTGGAACTTAGGTTTTGGTCCAGACAATTGAACCAAGTGTGAAAGCACCCTATAAGTGCTTTGTACCAATTCATCAATTTAAATGTACATGCATAGTAGTTAAGTCCACATAATATGAAGGAGAACCTTGCAATCTTCTAACCACAACTGTTCTTTTTTTGTCAGGTTATAGTTGAACAGTTTGTCAAGTCTAGCCCTAATGGTCTTAAGGTGATGTACGCAAAGCTGTTAGAGTTTGTGCCTCATCACTGCAGACTTCTGCGAGAGGTGACCGGTGGCGCAATCTCTAGG[T/C]ATGTTTGCCACTCACATAAAACTTTTACAGCATTGAGCCATTGTAGTCAGATCATACACAATATATTTTAATGAGCTTCCCTTTATGCACATCTAGTGATAAAGCTGACATTGTTCCCGGATACGACTTCCTAGTGAACTCCGTTTGGCCTGAAATCATTAGAGGTGTTGAGGAAAGAGTCCCTTCTCTTTTTAATCCCGGAAACCCAGATGTGTTTTATGAGGTGAACAAAGCAAAAAAAAAAAAAGTGCATTCATATTTTCTATAAAGTTTGGAGGATACATATAAAACTTTTTTTGCAGTTTTGACTGAAGTTAAAATTTGTCTTAATTTTTTTTATTTGTCTTTAAATTTATGTCTTGTATTCGTGCAGAGATACACTGTCAGCATGGATTTTGTGCGTAAGTTTGAGAGGCAGTGTGGTTCTCAGGCCAGTGTGAAGAGGTTGCGAGCACATCCAAGCTACCAGAGCTTTCACAACAAATGGAACCTGCCAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8564
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026189 Essential Splice Site 455 730 12 18
Genomic Location (Zv9):
Chromosome 13 (position 24226996)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23872656
GRCz11 13 24003106
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAACTCAYTCTGCAGCTCATCTCCAGATACTCCACCTTTCTTACCGAGG[T/C]AATGCATTYCAGCTGAGAGGAATTTGAATCATAATAATAGAGTTATTGTT
Long Flanking Sequence:
AGCTTGATTCCGTTATGCTCAAAATACACCCATAACTCGTTAAGAGAATAAGCACAACCCTGTTAGACCATGTGCCAGGATGCATAGATAATTTTTCTATTTTTAAAATAGCAGAAGTGGATAAGGACACGCGCAATGTGCTTTAGACTTTGCGCCTAGATCGTTAAAATAGAGCCCAATGTGTTTTTTGTTAATGTGACAATGAATGCATCATAAAGATGTGTGGTCTATCCTTCTCTGTACACCTGTTGACCTGCCTTTTATGATAAATATAAAGCTGTCACTTTTAAGAGAGTGTAACAGATCAGCACTGACATCCAGTCTGCTCTGTGTATTTGTGAACGCAGTGGGCAGCAGCTTCCACCTGCAGGTGACCGAGGTGTTGTGGAGCTGTGTGTGCAGGTGCTGGACTGACCAGGTGTACTTGCCACCCCTCGCTCATCGGTTCTGGAAACTCACTCTGCAGCTCATCTCCAGATACTCCACCTTTCTTACCGAGG[T/C]AATGCATTCCAGCTGAGAGGAATTTGAATCATAATAATAGAGTTATTGTTCATGTCTTCCTTTTTTTGTCTCACAGGTTCTAACAAAAACATCATCTACAGAGGCAAGCAAAGATTCAGTAAGGCCGCTTCCCAGCTCTGCATCTTCCACATCCAGCCGCACATCACAGGATGCAGACAGTGAAACTGGCGGTCCCACTGTTTTATCTACTAAACAGCTTTTCTTCATTGCAGCTGATGTTGATAAGTTACAAGGAAAGGTAATTCAAATGTTCATTTAAAATAGTTTACAGAGTCCTCGTGCTTTTTTTTTTTCCTTTTTCTTTTTTTCAAAACAGTTTAGAACAAAAAACATTTTCAAAGGAACATGGAAATAGAAAAGACATATAATACAGGTGCCAAAGGTCACCCAATACAATGTTATTTACATTCGTATTTATGGTTGTTAAAATGTTGCTATATAAAATTTTGTTAAGGGTTACATATCAGGCTCCAGAAATA
Associated Phenotype:
Not determined